Labshake search
Citations for Qiagen :
751 - 800 of 3908 citations for 2R 5S 5 4 amino 5 fluoro 2 oxopyrimidin 1 2H yl 1 3 oxathiolan 2 yl methyl butyrate WXC04778 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (911021, Qiagen, USA). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Molecular Biology 2022Quote: ... a proteinase K reaction solution containing 5 μL of PKD buffer (QIAGEN) and 0.31 μL of ProK (QIAGEN ...
-
bioRxiv - Neuroscience 2022Quote: ... one 5 mm bead per sample was used in a TissueLyser (Qiagen) for 4 min at 30 Hz ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I and 200 µg/mL RNase A (Qiagen). Followed by a mild sonication (10 strokes ...
-
bioRxiv - Cancer Biology 2023Quote: ... we manually dispensed 5 μL of Vapor-Lock (Qiagen, cat. no. 981611) into each well in the targeted region of a 384-well plate ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 5×106 cells using the RNeasy minikit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... the reaction tubes were added 5 μL of PureGene Proteinase K (Qiagen) and incubated for additional 30 minutes at 50°C ...
-
bioRxiv - Microbiology 2022Quote: ... then 5 µl of RNAse A (10 mg/ml; Qiagen, Hilden, Germany) was added and the sample was incubated for 30 min at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... and purified by affinity chromatography using a 5 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Biophysics 2024Quote: ... corresponding to ∼5 L per sample (RNeasy PowerSoil Total RNA Kit; Qiagen). The RNA was tested with Bioanalyzer ...
-
bioRxiv - Microbiology 2024Quote: ... (5) DNA was purified after reverse crosslinking using a MinElute column (Qiagen) as directed and quantified by a Qubit fluorometer (Invitrogen).
-
bioRxiv - Microbiology 2024Quote: ... 5 ml of the culture was mixed with RNAprotect Bacteria Reagent (QIAGEN) at a 1:2 ratio ...
-
bioRxiv - Microbiology 2024Quote: ... 5 PCRs were pooled and purified on one Qiaquick spin column (Qiagen) following manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2024Quote: ... trigynum homostyle=5 individuals) using the RNeasy Plant Mini Kit (QIAGEN, Germany). Libraries were sequenced on an Illumina NovaSeq S1 Sequencing System to produce paired-end 150bp read length reads ...
-
bioRxiv - Cancer Biology 2021Quote: Whole RNA (1-3 μg total per 10 μL volume) was isolated using RNAeasy mini kit (QIAGEN) or TRIzol (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Pelleted cells were resuspended in 1 ml of Na2CO3 buffer containing 3 µg/ml RNase A (Qiagen) and incubated at 50°C for at least 4 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... was achieved from frozen tissue biopsies upon homogenization with stainless steel beads (3–7 mm mean diameter) using TissueLyser II (QIAGEN; 20” at 30 Hz, for 2 cycles(20)) ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2× volume of RNAprotect Bacteria Reagent (QIAGEN) for 10 min at room temperature and collected as pellets by centrifugating for 10 min at 5,000×g ...
-
bioRxiv - Genomics 2024Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 ml of RNAprotect® Bacteria Reagent (cat # 76506, Qiagen Inc.) was added ...
-
bioRxiv - Microbiology 2021Quote: ... was modified by a custom-added biotin residue at its 5’-end (Qiagen). Hybrids of the CoV-2 RNAs with the probe were detected with a goat anti-biotin antibody conjugated to 10 nm gold particles (BBI international).
-
bioRxiv - Cell Biology 2020Quote: ... mRNA samples were concentrated to ≤ 5 µl by MinElute column (QIAGEN, Cat. 74204). For generation of RNA-seq libraries ...
-
bioRxiv - Immunology 2021Quote: RNA was isolated from ~5 x 105 cells using RNeasy mini kits (Qiagen), typically yielding 100-400 ng RNA ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were homogenized using 5 mm steel beads and a Tissuelyser II (Qiagen) operated at 30 Hz for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... 5 U/ml dispase (Stemcell) and 50 mg/ml DNase I mix (Qiagen) in complete RPMI1640 medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was isolated from 5 million cells using the DNAeasy kit (Qiagen). 4ug gDNA was digested with NlaIII or MseI ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 μl of 10% SDS and 5 ul of Proteinase K (Qiagen #19131) were added to each sample ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 10x CoralLoad PCR buffer and 5 µl of TopTaq Master Mix 2x (Qiagen). An initial denaturation cycle of 94°C for 6 min was followed by 35 cycles of 94°C for 45 s ...
-
bioRxiv - Biochemistry 2022Quote: ... The cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed in two steps with lysis buffer supplemented with 25 and 50 mM imidazole ...
-
bioRxiv - Physiology 2022Quote: ... mRNA samples were concentrated to ≤ 5 µl by MinElute column (QIAGEN, Cat. 74204). For generation of RNA-seq libraries ...