Labshake search
Citations for Qiagen :
751 - 800 of 1774 citations for 2 Triisopropylsilyl Oxazole 5 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... then 50 mg transferred to 2 ml Plant Pro tissue disruption tubes (Qiagen Ltd, U.K.). DNA was extracted following manufacturers protocol ...
-
bioRxiv - Microbiology 2024Quote: ... run using the QIAcuity One Digital PCR System (Qiagen, 2-plex Device, Cat. No. 911001). The following conditions were used for the one-step cycling dPCR program ...
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen, Toronto, ON, Canada). Then ...
-
bioRxiv - Molecular Biology 2023Quote: ... clusters (0-2) were predicted with Ingenuity Pathway Analysis (IPA; version 90348151, Ingenuity Systems, Qiagen), using the cluster marker gene lists (adj ...
-
bioRxiv - Immunology 2024Quote: ... using primers (Supplementary Table 2) and purified the products using QIAquick PCR Purification Kit (Qiagen). PCR-products were Sanger sequenced and knockout scores were determined using the ICE analysis tool (https://ice ...
-
bioRxiv - Microbiology 2024Quote: ... or AZD5582 in the presence or absence of KL-2 using an RNeasy kit (Qiagen), with the optional on-column deoxyribonuclease I digestion step ...
-
bioRxiv - Immunology 2024Quote: ... Sorted cells (2-4x104 per sample) were resuspended in 350 µl RNeasy Lysis Buffer (QIAGEN), and RNA was extracted using the QIAGEN RNeasy Mini kit (QIAGEN) ...
-
bioRxiv - Genomics 2023Quote: ... Cell-free RNA was isolated from between 2-8 mL following manufacturer’s instructions (Qiagen, 55114). Isolated RNA was DNase-treated (Lucigen ...
-
bioRxiv - Genetics 2023Quote: ... we extracted genomic DNA from 2 million cells using DNeasy Blood & Tissue Kit (69504, Qiagen) and performed droplet digital PCR (ddPCR ...
-
bioRxiv - Plant Biology 2023Quote: Genomic DNA was extracted from 2-week old seedlings with DNeasy Plant Mini Kit (Qiagen) and further purified with Isolate II Gel and PCR Clean-up Kit (Bioline) ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit ...
-
bioRxiv - Biochemistry 2023Quote: Total RNA was extracted from 1 – 2 x 108 cells using the RNeasy kit (Qiagen). DNA was removed using Turbo DNase (Applichem ...
-
bioRxiv - Microbiology 2024Quote: ... with 200 µl of the resulting supernatant transferred into 2 ml EZ1 sample tubes (Qiagen). 12 µl of Proteinase K was added to the supernatant ...
-
bioRxiv - Immunology 2023Quote: ... DNA was isolated for each fraction using EZ1&2 DNA Blood 350µL kits (Qiagen, Hilden) and the EZ1 Advanced XL automated system (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... The initial homogenization was performed mechanically (2 metal beads/sample) using a TissueLyserLT (#85600, Qiagen) homogenizer (50 oscillations/s for 10 min) ...
-
bioRxiv - Microbiology 2022Quote: ... and 1% penicillin–streptomycin) at 300 Hz for 2 min using a Tissuelyser II (Qiagen) and were then centrifuged to clarify the supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... MAYV samples were homogenized at 30 Hz for 2 min in a TissueLyser II (Qiagen) and centrifuged for 30 sec at 11,000 rpm ...
-
bioRxiv - Genomics 2023Quote: ... RNAse A treatment was conducted by adding 2 uL of RNAse A 100ug/mL (Qiagen) and incubating the samples at 37°C for 15 min ...
-
bioRxiv - Plant Biology 2024Quote: ... all samples were ground for 2 minutes at 25 Hz (TissueLyser II, QIAGEN, Hilden, Germany). A dilution series was performed on this mixture with MgCl2 (10 mM ...
-
bioRxiv - Immunology 2024Quote: ... PCR products were purified from 2 % agarose-gels using QIAquick Gel Extraction Kit (QIAGEN, 28706) for Sanger sequencing (Microsynth).
-
bioRxiv - Microbiology 2024Quote: ... The paper circles were transferred to PowerBead Pro Tubes (2 ml) (cat. no. 19301, Qiagen) containing pre-loaded homogenization beads.
-
bioRxiv - Immunology 2024Quote: ... 2×106 MDSCs were used for RNA extraction using the Rnaeasy Plus Kit (Qiagen # 4134), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL of sonicated RNA per sample was purified with miRNeasy Micro Kit (Qiagen, 217084) and treated with DNase I (Qiagen ...
-
bioRxiv - Developmental Biology 2024Quote: ... 15 mM DTT) and then treated with 2 μL of 4 mg/mL Protease (QIAGEN) by incubation at 55°C for 6 hours ...
-
bioRxiv - Microbiology 2022Quote: ... LF/LF = 5 mice from two cages over two experiments) using the DNeasy PowerSoil Kit (Qiagen, Germantown, MD). Modifications to the standard protocol included a 10-minute incubation at 65°C immediately following the addition of the lysis buffer and the use of a bead mill homogenizer at 4.5 m/s for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-Seq libraries were prepared from 5 ng total RNA using the NEB Next RNA Ultra Kit (QIAGEN) with poly(A ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... 20 mM imidazole was added to the supernatant and incubated with 5 mL of Ni-NTA resin (Qiagen) with a stirring magnet at 4°C for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Immunology 2022Quote: ... and 5 cells per well were sorted into a 96-well plate containing TCL buffer (Qiagen, cat. 1031576) with 1 % beta- Mercaptethanol and snap frozen on dry ice ...
-
bioRxiv - Biophysics 2022Quote: ... The suspension was spun down at 16,000 r.c.f at 4 °C for 30 min and the supernatant was applied 5 ml Ni-NTA resin (Qiagen)/ L culture medium ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... total DNA from 5 × 105 J-Lat cells was purified using Qiagen blood mini kit (Qiagen, Hilden, Germany) and quantitated spectrophotometrically ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated from 5 × 105 cells with the AllPrep© DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA for expression analyses was extracted from 5 day-old protonemata using a RNeasy Plant Mini Kit (Qiagen). Genomic DNA removal and cDNA synthesis were performed with a Quantitect Reverse Transcription kit (Qiagen).
-
bioRxiv - Developmental Biology 2021Quote: Log fold-change values of the top 5% proteins were used as input for Ingenuity Pathway Analysis (Qiagen: https://digitalinsights.qiagen.com/products/features/) ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from 5×106 cells per sample using the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN) according to manufacturer’s recommendations with additional DNase I treatment for RNA extraction ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... A 5 ml aliquot of culture was removed and added to 10 ml of RNAprotect Bacteria Reagent (Qiagen) and mixed by vortexing ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Physiology 2023Quote: ... a 5 mg piece of kidney tissue was homogenized in 350 μL of RNeasy RLT Lysis buffer (Qiagen) containing 2-mercaptoethanol and centrifuged at maximum speed for 3 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Edmund Bühler) by bead beating twice for 5 min at 30 Hz in a Tissue Lyzer II (QIAGEN). Lysates were then incubated for 30 min at 37 °C with shaking ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were eluted using an imidazole gradient and subsequently loaded onto a 5 ml StrepTactin Superflow Cartridge (Qiagen) at a flow rate of 0.8 ml/min ...