Labshake search
Citations for Qiagen :
7801 - 7850 of 10000+ citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Plasmid DNAs were initially isolated using a maxiprep kit (Qiagen). To remove nicked plasmid species ...
-
bioRxiv - Biochemistry 2020Quote: ... and was purified using a QIAquick PCR purification kit (Qiagen). The ChIPed DNA was assessed qPCR as described above ...
-
bioRxiv - Immunology 2020Quote: ... RNA was isolated using RNeasy Mini or Micro kits (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was extracted using the RNeasy Plus Micro Kit (Qiagen), together with a genomic DNA eliminator column and a 30-minute incubation with DNAse I (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted using the RNeasy Mini kit (Qiagen) and subjected to sequencing using the HiSeq 2500 platform (Illumina) ...
-
bioRxiv - Neuroscience 2021Quote: RNA extraction was performed using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instruc tions ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was generated with the Quantitect Reverse transcription kit (Qiagen). Using the 2-ΔΔCt method ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted using QIAsymphony RNA kit (#931636, Qiagen). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... total small RNAs were isolated using miRneasy Mini kit (Qiagen) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was isolated using the RNeasy Mini Kit (QIAGEN) and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2020Quote: ... neurite RNA was isolated using RNAeasy Microisolation Kit (Qiagen, CA).
-
bioRxiv - Neuroscience 2020Quote: ... the overlap extension product was purified (QIAGEN, PCR purification kit). The mScarlet-I sequence (based on Addgene Plasmid #85068 ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by clean-up with the RNeasy Mini Kit (Qiagen). Total RNA yield and quality was determined using a NanoDrop ND-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... The RNA was purified using miRNeasy® Mini Kit (Qiagen), and all samples had RIN values >7.5 ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated by using the RNeasy Kit (Qiagen), and cDNA synthesis was performed using SuperScript II Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA produced with the Omniscript RT Kit (Qiagen, #205111) with oligo dT primers ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated with the RNeasy Mini Kit (Qiagen, #74104) and cDNA produced with the Omniscript RT Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated using the RNeasy Mini Kit (Qiagen) from Trp53 KO or Trp53 mutant astrocytes ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA was isolated using the RNeasy Mini Kit (Qiagen). RNA quality was assessed using BioAnalyzer 2100 and/or TapeStation RNA Screen Tape (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... and the RNeasy Plus RNA Extraction Kit (Cat# 74134, Qiagen). cDNA was generated using the TaqMan Reverse Transcriptase Kit according to the manufacturer’s instructions (Cat# N8080234 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was extracted using RNeasy Mini kit (Qiagen, cat# 74104), followed by quality assessment via Agilent 2200 Tape Station ...
-
bioRxiv - Biophysics 2020Quote: ... and DNA was extracted using the Blood Mini Kit (Qiagen). Early (RU5 ...
-
bioRxiv - Genomics 2019Quote: ... DNA was extracted using the QIAamp DNA Micro Kit (Qiagen). The extraction followed the protocol of the manufacturer ...
-
bioRxiv - Cancer Biology 2020Quote: ... samples were subjected to Allprep DNA/RNA Mini Kit (QIAGEN) following the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were purified using QIAquick PCR Purification kit (Qiagen). PCR products were followed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... and root tissues using a Qiaprep Spin Miniprep kit (Qiagen). At 14 d (16 days post-inoculation ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen), followed by PCR using the primers ACACGCTTGGGAATGGACAC and CCATGGGAAGATGTTCTGGG and separation on 4% agarose ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated using the RNAeasy Mini Kit (Qiagen), and cDNA was synthesised using SuperScript III (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and DNase treated with the RNase-Free DNase kit (Qiagen) following manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RNA was extracted using RNeasy Micro Kit (Qiagen #74004). RNA concentration was assessed with a Nanodrop spectrophotometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was extracted with the RNeasy mini kit (Qiagen). PolyA-tailed mRNA was selected with beads from 1μg total RNA using the NEBNext Poly(A ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted with the RNeasy Plus kit (QIAGEN) and reverse transcribed using iScriptΪ™ Select cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was isolated using the miRNeasy mini kit (217004, Qiagen [WERFEN ESPAÑA ...
-
bioRxiv - Cancer Biology 2020Quote: ... using miScriptSYBR Green PCR kit (Perfect Real Time) (Qiagen, #218161). Reaction mixtures were incubated for 10 min at 95 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted using the RNeasy Mini kit (QIAGEN) following the protocol for “Purification of Total RNA from Plant Cells and Tissues and Filamentous Fungi” including an on-column DNAse digest ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted from cells with an RNeasy Kit (Qiagen) and was sequenced using Illumina TruSeq strand specific library ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted from cells using the RNeasy kit (Qiagen), and subsequently converted into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermofisher) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cDNA wassynthesized using the miScript II RT kit (Qiagen). Quantitative PCR was performed using the SensiFAST SYBR Hi-ROX kit (Bioline ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: RNA was extracted with the RNA easy mini kit (Qiagen) and proteins were extracted by cell lysis in Laemmli buffer (50 mM Tris-HCl (pH 7.5) ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... mRNA was extracted and purified with RNeasy Mini kits (Qiagen). Total RNA (200 ng ...
-
bioRxiv - Cell Biology 2021Quote: RNA isolation was performed with the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted with RNeasy mini kit (74104, Qiagen), and quantified (Nanodrop 2000) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated using an RNAeasy Mini Kit (Qiagen, Germany) and then converted into cDNA using PrimeScript RT Master Mix (Takara Bio Inc ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted with the RNeasy Mini kit (Qiagen, 74104) according to the manufacturer’s instructions and sample concentrations were determined by NanoDrop ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated using the RNeasy kit (Qiagen 74106) and reverse transcribed into cDNA using the qScript cDNA synthesis kit (Quanta 95048–500) ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was isolated using miRNeasy RNA purification kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... and target amplicons were extracted using DNA extraction kit (Qiagen). 10 ng of purified PCR products were incubated with I-SceI endonuclease (NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA extractions were performed using an RNeasy Micro Kit (Qiagen), followed by cDNA synthesis using the QuantiTect Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2019Quote: ... The AllPrep DNA/RNA kit Micro (#80284, Qiagen, Germantown, MD) was used to extract gDNA from each sample10 ...
-
bioRxiv - Genomics 2020Quote: RNA was extracted using the RNeasy plus kit from QIAGEN. For the cell lines ...