Labshake search
Citations for Qiagen :
7751 - 7800 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... followed by extraction using the RNeasy Mini Kit (Qiagen, Hilden Germany). RNA (1 µg ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was extracted from miRNeasy kit from Qiagen (cat. No. 217004) and mRNA-seq was performed as described before [96].
-
bioRxiv - Neuroscience 2021Quote: ... DNA was purified and eluted using MinElute PCR purification kit (Qiagen). Libraries were sequenced at the Max Planck Institute of Immunology and Epigenetics using HiSeq 3000 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA extraction was performed immediately thereafter using RNAeasy Kit (Qiagen, 74104) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA was extracted with the RNeasy mini kit (Qiagen, 74106) plus on-column DNAse I digestion (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated using the RNeasy mini kit (Qiagen, # 74104). Following RNA isolation ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated using the RNeasy Plus Mini kit (74134, Qiagen) and sent to the Weill Cornell Medicine Genomics Core facility ...
-
bioRxiv - Cancer Biology 2021Quote: ... The total RNA was extracted using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from the cells using RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was first extracted using Qiagen RNEasy kits (Qiagen, Hilden, Germany). cDNA was then created from the RNA samples using an iScript kit (BioRad ...
-
bioRxiv - Genomics 2021Quote: ... and DNA was purified with QIAquick PCR purification kit (QIAGEN 28106). ChIP-seq libraries were constructed using the Illumina’s TruSeq ChIP sample preparation kit (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was then isolated using the RNeasy mini kit (Qiagen, 74104). Expression data were generated using Affymetrix Clariom S arrays.
-
bioRxiv - Cancer Biology 2021Quote: ... and the RNeasy PowerLyzer Tissue & Cells Kit (Qiagen, CAT # 15055-50) was used to extract RNA from peripheral blood mononuclear cells (PBMCs ...
-
bioRxiv - Microbiology 2020Quote: ... and then total RNA was extracted using a RNeasy kit (Qiagen). Genomic DNA was removed using the Turbo DNA-free kit (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA extraction was completed using RNEasy mini kit (Qiagen, 74106) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Total cellular RNA was extracted using an RNeasy mini kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: Total DNA was prepared using DNeasy Blood and Tissue Kit (Qiagen). Validated primers for Mitochondrial (CCCATTCCACTTCTGATTACC ...
-
bioRxiv - Molecular Biology 2020Quote: DNA was extracted using the DNeasy Blood and Tissue kit (QIAGEN); quality and concentration were verified using a UV-Vis spectrophotometer (Thermo Scientific NanoDrop One) ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: Total RNA was purified by using RNeasy mini kit (Qiagen #74104) by following the company's instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Precipitated DNA samples were purified by QIAquick PCR purification kit (Qiagen) and quantified by Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was extracted from cell pellets (DNeasy Blood & Tissue Kit, Qiagen) and stored at −80°C until completion of screens ...
-
Chromatin accessibility changes at intergenic regions associates with ovarian cancer drug resistancebioRxiv - Cancer Biology 2021Quote: ... DNA was isolated from cells using the Gentra PureGene kit (Qiagen). 1μg purified DNA was sheared using Bioruptor Pico (Diagenode ...
-
bioRxiv - Cell Biology 2020Quote: RNA samples were extracted using the RNeasy Mini kit (Qiagen, 74104), and the quality of total RNA was assessed by the 2100 Bioanalyzer (Agilent ...
-
bioRxiv - Cell Biology 2020Quote: After RNA extraction using the RNeasy Micro or Mini Kit (QIAGEN), quantitative PCR (qPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA from spleen was digested overnight with DNeasy extraction kit (Qiagen) for further downstream qPCR analysis.
-
bioRxiv - Cell Biology 2020Quote: ... RNA was isolated using the RNeasy RNA purification mini kit (QIAGEN) or GeneJET RNA purification kit (Thermo Fisher (according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was isolated with the DNeasy Blood & Tissue kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and the DNA was purified using the PCR Purification kit (Qiagen). Purified DNA was then subjected to quantitative PCR using three sets of primers targeting the promoter region of atgl-1 ...
-
bioRxiv - Cell Biology 2020Quote: ... exosomal RNA was isolated using the miRNeasy Serum/Plasma Kit (QIAGEN) followed by reverse transcription using the TaqMan MicroRNA Reverse Transcription Kit (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... cell-derived microvesicles were collected using the ExoEasy Kit (Qiagen 76064) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was isolated from cells using a Gentra Puregene kit (Qiagen). DNA was quantified by fluorometry using QuBit 2.0 (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: Genomic DNA was extracted using a Gentra Puregene Core kit (Qiagen). Lentiviral sgRNA inserts were amplified in a two-step PCR (with Illumina adapters added on the second PCR) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was reverse-transcribed with the miScript II RT Kit (Qiagen) and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and cDNA was synthesized using the QuantiTect Reverse Transcription kit (QIAGEN). SybrGreen quantitative RT-PCR experiments were performed as described in the manual using QuantStudio™ 6 Flex Real-Time PCR System ...
-
bioRxiv - Cell Biology 2020Quote: ... Subsequently cDNA was generated employing the QuantiNova Reverse Transcription Kit (Qiagen) according to recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was collected 7 days post-TGFB1 treatment (RNAeasy Kit, Qiagen). cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... Plasma vRNA was extracted by QIAamp Viral RNA Mini Kit (QIAGEN) and quantified by real time PCR (ABI Applied Biosystem ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was isolated using QIAamp DNA Micro Kit (56304, Qiagen). The number of genomic viral integration sites was compared with the number of housekeeping genes using a ddPCR—BioRad QX200 AutoDG Droplet Digital PCR System (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... and DNA fragments were then purified with QIAquick PCR kit (Qiagen). A 10% input sample of each condition was used to generate a standard curve and the copy numbers of each immunoprecipitate is presented relative to the standard curve ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was harvested using the DNeasy blood and tissue kit (Qiagen). The qPCR assays were carried out in a LightCycler96 system (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: RNA was isolated from cells using a RNeasy mini kit (Qiagen), and then 400 ng to 1 μg of RNA was DNase I-treated according to the manufacturer’s protocol (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... RNA was prepared using the RNeasy Micro kit (Qiagen, Cat: 74004), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... from total RNA extracted with the RNeasy Plant Mini Kit (Qiagen). The FLOE2 and FLOE3 amplicons were then BP recombined into pDONR221 before being transferred into pGWB605 by LR recombination to generate p35S:FLOE2-GFP and p35S:FLOE3-GFP.
-
bioRxiv - Cell Biology 2020Quote: ... The sonicated DNA was purified with a PCR purification kit (Qiagen) and used to prepare Illumina libraries with the NEB Next Ultra Library Prep kit (Illumina) ...
-
bioRxiv - Cell Biology 2020Quote: ... and RNA was isolated using the RNeasy Mini Kit (Qiagen 74104) or Quick-RNA MicroPrep (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... and DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen). Each sub-pool was cloned into pDEST (pAWH or pBWH ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted using the RNeasy kit (Qiagen, Valencia, CA). Reverse transcription of RNA was done using the TaqMan reverse transcription reagent kit (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was isolated with the RNeasy Micro Kit (Qiagen, Cat# 74004). Synthesis of cDNA and q-PCR were performed using established standard protocols.
-
bioRxiv - Immunology 2021Quote: ... transposed DNA was isolated using the MinElute PCR Purification Kit (QIAGEN), followed by x5 PCR cycles using a combination of a PCR primer and an index PCR primer ...