Labshake search
Citations for Qiagen :
701 - 750 of 3271 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The cleavage reaction was run over a 5 mL Streptactin column (Qiagen) to remove any uncleaved HELB and free StrepII peptide and the cleaved HELB-containing flow-through collected ...
-
bioRxiv - Immunology 2020Quote: Total RNA from 5×106 PBMCs was isolated using RNeasy kits (Qiagen). First-strand cDNA was generated from total RNA using SuperScript RT IV (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg RNA was DNase treated using RNase-Free DNase Set (Qiagen) and 1 μg of DNase treated RNA was then taken for cDNA synthesis using the Protoscript I first strand cDNA synthesis kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenization was performed with stainless steel beads of 5 mm (Qiagen) and TissueLyser LT (Qiagen) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with two 5 mm stainless beads using a TissueLyser (Qiagen, CA, USA) at 50 Hz for 4 min ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed in two steps with lysis buffer supplemented with 25 and 50 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: ... The lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen) and the column was washed with lysis buffer supplemented with 25 mM imidazole ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleared lysate was applied to a 5 mL Ni-NTA cartridge (Qiagen). The column was washed in two steps with lysis buffer supplemented with 25 and 100 mM imidazole ...
-
bioRxiv - Genomics 2021Quote: ... The scramble-miR miRCURY LNA Detection probe (5’-GTGTAACACGTCTATACGCCCA-3’, YD00699004, QIAGEN) was used as a negative control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cleared lysate was loaded on a 5 mL Ni-NTA column (Qiagen) equilibrated with buffer C ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... Worms were homogenised with a 5 mm diameter stainless steel bead (Qiagen) for 4 min at 50 Hz in 100 µl of 0.15 M McIlvaine buffer pH 4.6 [64] with EDTA-free protease inhibitors (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 5×106 cells using the RNeasy minikit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... the reaction tubes were added 5 μL of PureGene Proteinase K (Qiagen) and incubated for additional 30 minutes at 50°C ...
-
bioRxiv - Microbiology 2022Quote: ... then 5 µl of RNAse A (10 mg/ml; Qiagen, Hilden, Germany) was added and the sample was incubated for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... a proteinase K reaction solution containing 5 μL of PKD buffer (QIAGEN) and 0.31 μL of ProK (QIAGEN ...
-
bioRxiv - Neuroscience 2022Quote: ... one 5 mm bead per sample was used in a TissueLyser (Qiagen) for 4 min at 30 Hz ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I and 200 µg/mL RNase A (Qiagen). Followed by a mild sonication (10 strokes ...
-
bioRxiv - Microbiology 2023Quote: ... maintained on ice and homogenized using 5 mm stainless steel beads (Qiagen) on a minibeadbeater (BioSpec ...
-
bioRxiv - Microbiology 2023Quote: ... Harvested cells were fixed overnight in 5 mL RNA Protect reagent (Qiagen) after incubation with compounds ...
-
bioRxiv - Microbiology 2023Quote: ... 5-10g of peat materials (preserved in Lifeguard soil preservation solution, Qiagen) was added into bead tubes ...
-
bioRxiv - Biochemistry 2022Quote: ... and purified by affinity chromatography using a 5 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (911021, Qiagen, USA). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Cancer Biology 2023Quote: ... we manually dispensed 5 μL of Vapor-Lock (Qiagen, cat. no. 981611) into each well in the targeted region of a 384-well plate ...
-
bioRxiv - Biophysics 2024Quote: ... corresponding to ∼5 L per sample (RNeasy PowerSoil Total RNA Kit; Qiagen). The RNA was tested with Bioanalyzer ...
-
bioRxiv - Microbiology 2024Quote: ... 5 PCRs were pooled and purified on one Qiaquick spin column (Qiagen) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... 5 ml of the culture was mixed with RNAprotect Bacteria Reagent (QIAGEN) at a 1:2 ratio ...
-
bioRxiv - Microbiology 2024Quote: ... (5) DNA was purified after reverse crosslinking using a MinElute column (Qiagen) as directed and quantified by a Qubit fluorometer (Invitrogen).
-
bioRxiv - Evolutionary Biology 2024Quote: ... trigynum homostyle=5 individuals) using the RNeasy Plant Mini Kit (QIAGEN, Germany). Libraries were sequenced on an Illumina NovaSeq S1 Sequencing System to produce paired-end 150bp read length reads ...
-
bioRxiv - Cell Biology 2024Quote: ... or p300 (Qiagen, Sequence: 5′-TAG TCT GGT CCT TCG T-3′) for 24hr ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...