Labshake search
Citations for Qiagen :
701 - 750 of 3281 citations for Fipronil 3 Cyano Pyrazole 3 4 5 13C4 99%; 3 Cyano 5 15N2 98% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... Approximately 150 mg FW of frozen plant material was disrupted with a glass and a metal bead (Ø 3 mm; QIAGEN GmbH, Hilden, Germany) in a TissueLyser (MM400 ...
-
bioRxiv - Genomics 2019Quote: DNA from EndoC-βH1 cells exposed or not to IL-1β and IFN-γ for 48h as described above (3 replicates per condition) was extracted using QIAamp DNA Mini kit (Qiagen, Venlo, The Netherlands). 1 μg DNA aliquots (n=3 ...
-
bioRxiv - Plant Biology 2022Quote: RNA samples were isolated from seedlings at each time point with 3 biological replicates using Qiagen Plant RNA extraction kit (Qiagen, Germany; Cat. No. 74904). A total of 18 cDNA libraries were prepared following the standard BGISEQ-500 RNA sample preparation protocol and sequenced by the DNBseq platform (BGI ...
-
bioRxiv - Neuroscience 2023Quote: ... Dissociated microvascular cells were stained for flow cytometric analysis or were additionally processed with myelin removal beads (Miltenyi 130-069-731) and 3 sequential positive selections with CD31 microbeads (Miltenyi 130-097-418) for RNA isolation (Qiagen RNeasy Micro Kit 74004). cDNA library preparation used Oligo-dT at 60 million clusters/sample (University of Chicago Genomics Facility).
-
bioRxiv - Genetics 2022Quote: Total RNA was extracted from the stomach and pyloric caeca tissue samples stored at -80 °C (n = 4 for control and fly larvae, n = 5 for shrimp shell) using the RNeasy Plus Universal Kit (QIAGEN). RNA quality was assessed using a 2100 Bioanalyzer with the RNA 6000 nano kit (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... and adult females (approximately 4-5 of each) were prepared for RNAseq using the RNeasy Blood and Tissue Kit (Qiagen). Individuals were placed in a 1.5 mL safelock tube along with 5-8 one mm glass beads placed in liquid nitrogen and then shaken for 30 s in a Silamat S6 shaker (Ivoclar Vivadent) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were pelleted at 350 x g for 5 min at 4 °C and lysed in 350 μl RLT buffer of the RNeasy Mini Kit (Qiagen). RNA was isolated according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and 3-week-old) and leaves (4-, 5-, and 6-week-old plants) was isolated and purified using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: mRNA was isolated from Boyden chamber migration assay-derived Treg pellets from 5 HD and 4 uRRMS patients using RNeasy micro kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were isolated from 5 mL of overnight liquid culture using QIAprep Spin Miniprep Kit (Qiagen, Germany) and the presence of mutations was confirmed by Sanger Sequencing.
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was loaded onto a gravity column containing 5 ml of 50% Ni-NTA resin (Qiagen) pre-equilibrated with 40 ml lysis buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... Condensin I was bound to Glutathione Sepharose 4B beads (Cytiva) in a 5 mL polypropylene column (Qiagen) using GST- tagged mSMC4 and eluted by PreScission Protease (Cytiva ...
-
bioRxiv - Genomics 2021Quote: DNA was extracted from the donors’ peripheral blood (5 ml) using DNeasy Blood & Tissue Kit from QIAGEN according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... samples were defrosted and incubated in 1 ml of RNAprotect cell reagent (Qiagen, 5 min, 25°C). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was passed through a 5 mL column volume (CV) of Ni-NTA agarose resin (Qiagen: 30250). The column was then washed with 10 CV of His binding buffer (50 mM NaH2PO4 ...
-
bioRxiv - Cell Biology 2022Quote: ... The remaining lysate was then transferred to 15 ml tubes containing 5 ml lysis buffer and 150 μl Ni-NTA agarose beads (Qiagen, Venlo, Netherlands) and incubated for 4 h at room temperature under constant mild agitation ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 μL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Stainless steel 5 mm beads (Qiagen, Germany) were additionally sterilised by heating at 220°C for 3 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5 mm stainless steel beads (Qiagen) at 30 Hz for 3 min at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 mm stainless steel beads (Qiagen) for 4 minutes at 24,000 rpm ...
-
bioRxiv - Genetics 2023Quote: ... 5 ul of 5X Q-solution (Qiagen), 1 ul of 5 mM 7-deaza-dGTP (NEB) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mm diameter stainless steel bead (Qiagen) was added to all the tubes and the tissue was homogenised in TissueLyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and stainless-steel beads (5 mm, Qiagen) before RNA isolation using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... using stainless steel beads (5 mm; Qiagen). RNA was then extracted using a RNeasy Mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Neuroscience 2024Quote: ... using 5-mm stainless steel beads (Qiagen) at 25 Hz for 1.5-3min (Qiagen/Retsch Bead Beater) ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL of Puregene Proteinase K (Qiagen) were added and the reaction tube was incubated for additional 2 hours at 45°C ...
-
bioRxiv - Genomics 2019Quote: ... We used a 100 µm nozzle to sort single cells into 96-well plates containing 5 µl TCL buffer (Qiagen) with 1% beta-mercaptoethanol for Smart-seq2 and 384-well plates containing 0.6 µl 1% NP40 (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: DNA was extracted from fecal pellets (100 mg, n=5 per group) by the QIAmp Power Fecal DNA kit (12850-50, Qiagen). The V4 region of 16S rRNA gene was amplified ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from the bacterial strains grown in VL55 medium with 5 mM pyruvate using the Qiagen Genomic-tip 100/G DNA isolation kit and associated DNA buffers (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 2.5ug of the plasmid of choice was transfected into HEK293T cells together with 1 ug pVSV-G and 1.5 ug pCMVΔR8.2 using an Effectene transfection kit (Qiagen). Twenty-four hours after transfection ...
-
bioRxiv - Microbiology 2023Quote: ... subtilis 3610 genome (CP020102) (98) using CLC Genomics Workbench software (Qiagen). The enrichment at ribosomal RNA locations were eliminated and the number of reads mapped to each base pair in the genome was exported into a .csv file ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng of plasmid DNA was transfected into each well using Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427). Unless otherwise noted ...