Labshake search
Citations for Qiagen :
701 - 750 of 869 citations for 7 Bromo 4 chloro 6 methylquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Lysates were cleared by centrifugation at 20,000 rpm for 1 hour at 4°C and the soluble fraction was affinity purified by gravity column with Ni-NTA affinity resin (QIAGEN). The protein was eluted by 50 mM Tris pH 8 ...
-
bioRxiv - Biochemistry 2019Quote: ... Cell lysate was separated by centrifugation at 28000 x g for 45 min and 4°C and the supernatant was loaded onto a column containing 2 mL of Ni-NTA agarose (Qiagen) equilibrated with buffer A for 1 h for purification by nickel affinity chromatography ...
-
bioRxiv - Microbiology 2019Quote: ... Cell debris was removed by centrifugation at 20000 g for 40 min at 4 °C and the lysate incubated with Ni-NTA Agarose Beads (Qiagen). After washing ...
-
bioRxiv - Microbiology 2021Quote: ... The lysate was clarified by centrifugation at 10,000 × g for 30 mins at 4 °C and the supernatant was applied to an Ni-NTA affinity column according to the manufacturer’s instructions (Qiagen, Germany). Bound proteins were washed twice with wash buffer (50 mM NaH2PO4 ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from isolated neutrophils after the 1 and 4 hour EC challenges as well untreated controls using the miRNeasy Micro kit from Qiagen and libraries were generated using KAPA PolyA enrichment mRNA library prep ...
-
bioRxiv - Genetics 2019Quote: RNA was extracted from skin fibroblasts of individual II.4 and a healthy unrelated control using Rneasy RNA kit (Qiagen) then we performed reverse transcription using the iScriptTM cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Biochemistry 2019Quote: ... The lysate was centrifuged for 10 min at 16,200xg 4°C and 600 μL of the supernatant was added to a 50 μL slurry of Ni-NTA Agarose (Qiagen) that had been washed three times with 250 μL A3B-CTD lysis buffer without 2-mercaptoethanol and once with 250 μL of A3B-CTD lysis buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... worms were homogenized in PBS (50 μl/adult worm pair or 50 μl/1000 schistosomula) at 4°C using a TissueLyser II (Qiagen), homogenates were incubated overnight with mixing at 4°C and the supernatants collected by centrifugation at 15,000 g for 1 h at 4°C ...
-
bioRxiv - Genomics 2021Quote: ... To eliminate lipids supernatants were applied to a RNeasy column and centrifuged at 10,000 rpm and 4 °C for 1 min (Qiagen, 74104). The flow through was collected and protein concentrations were assessed using the Bradford assay ...
-
bioRxiv - Physiology 2021Quote: ... was homogenized using the Fisherbrand Bead Mill 4 and total RNA was extracted from homogenates using the RNeasy Tissue Mini Kit (Qiagen), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 80 µL of the mixture was then incubated for 45-60 minutes at room temperature or 4°C with 10 µL NiNTA resin (Qiagen) prewashed with His-SUMO Lysis buffer (20 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA from 700,000 to 1.25 million RGCs from 4 independent rat litters per developmental stage was isolated using the Qiagen RNAeasy kit from Qiagen, which included a 15 minutes On-column DNAse step ...
-
bioRxiv - Genomics 2021Quote: Strains were grown overnight in 50 ml YPD broth and genomic DNA was extracted from approximately 4×109 cells using a QIAGEN Genomic-tip 100/G kit (10223, QIAGEN) with minor modifications ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Lysates were cleared by centrifugation at 15000 x g for 30 min at 4 °C and incubated in Pierce 5 ml columns with Ni-NTA agarose beads (Qiagen) at 4 °C for 1 h ...
-
bioRxiv - Immunology 2021Quote: DNA was extracted from feces pellets using the Qiagen MagAttract PowerMicrobiome DNA/RNA EP kit (QIAGEN, Cat#27500-4-EP). The V4 region of the 16S rRNA-encoding gene was amplified from extracted DNA using the barcoded dual-index primers developed by Kozich et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were clarified by centrifugation at 24,000g at 4°C for 20 min and passed through 2 mL of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was isolated from a pool of 20 mechanically homogenized embryos at 96 hpf for each sample (n=4) using TRItidy G (AppliChem) and 500 ng of cDNA was synthesized using QuantiTect Reverse Transcription Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... Lysates were clarified by centrifugation at 12,000xg at 4°C and mixed with 200 µL of a slurry of Ni2+-NTA agarose (Qiagen #30210) that had been equilibrated in lysis buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 mg/mL Proteinase K (55°C for 1 hour) before being purified using the QIAquick PCR purification kit (QIAGEN). qPCR was performed on the Rotor-Gene 3000 (Corbett Life Science ...
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Immunology 2022Quote: ... Kidneys were mechanically disrupted with metal beads during 3 min at 4°C and DNA was then extracted using QIAmp DNA kit (Qiagen). Leptospiral DNA was specifically targeted using primers and probes designed in the lpxA gene (L ...
-
bioRxiv - Cancer Biology 2022Quote: 3 Type D and 3 Type V SCLC tumor-derived cell lines were treated with either vehicle (EtOH) or 4-OHT for 3 days and RNA was isolated using the RNeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: We euthanized groups of 20 to 30 zebrafish larvae by immersion in ice-cold water (below 4°C) and immediately performed RNA extraction using the RNeasy Mini Kit (Qiagen) and reverse transcription using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Passage 0 and 4 organoids were dissociated to single cell suspensions and DNA extracted using the QIAamp DNA Micro kit (Qiagen). The extracted genomic DNA was sheared and the fragments were end repaired ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA of LDOs in EM on day 4 after passage was extracted using the RNeasy Mini kit (QIAGEN, Hilden, Germany). After cDNA synthesis using the QuantiTect Rev ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were separated on a 4% agarose gel at 110V for 40 min and proper-sized products extracted using QIAquick gel extraction kit (Qiagen). Following denaturation in undyed loading buffer at 95°C for 3 min ...
-
bioRxiv - Neuroscience 2023Quote: RNA was isolated from hippocampal tissues of 4- and 9-month-old WT and Tau mice using RNeasy Mini kit from Qiagen with DNase digestion ...
-
bioRxiv - Immunology 2022Quote: mRNA was isolated from Boyden chamber migration assay-derived Treg pellets from 5 HD and 4 uRRMS patients using RNeasy micro kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting mixture was rotated at 4 °C for 60 min and then poured into a 1 mL polypropylene column (Qiagen). The resin was washed three times with 5 mL lysis/wash buffer and eluted in 0.25 mL fractions with Ni-NTA elution buffer (composition same as lysis/wash buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated for 30 min at 4 °C with 5 mL of Ni2+-beads (Qiagen Ni-NTA Superflow) equilibrated in lysis buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... freshly sorted cells were pelleted at 500 g for 10 minutes at 4° and then resuspended in RLT Plus buffer (Qiagen). Cells were vortexed and frozen for at least one day at −80° before being thawed on ice and processed for RNA using an RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the chromatin incubated at 67 °C for 4 h following a purification step with the QIAquick PCR Purification kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... beads were discarded and the supernatant containing reconstituted into ND A2AAR was incubated for 4 h with 250 µL of Ni-NTA resin (Qiagen) for separating from empty ND ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was isolated from fecal matter and gastrointestinal sections using the DNeasy HTP 96 PowerSoil Kit (Qiagen, 12955-4). All DNA was recovered in ultrapure water without additives and stored at −20 °C.
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Biochemistry 2023Quote: ... Filters were incubated at 55°C for approximately 4 h and the resulting lysates were purified with the DNeasy kit (Qiagen) using a slightly modified protocol49 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Developmental Biology 2023Quote: ... Supernatants were separated from lysates and incubated with affinity beads at 4°C overnight (His beads: Ni-NTA from QIAGEN; GST beads ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from the hippocampus of P65 females of all four groups (n=4/group) using the RNeasy Midi Kit (Qiagen). RNA samples were submitted to the University of Minnesota Genomics Center for library preparation and sequencing ...
-
bioRxiv - Bioengineering 2023Quote: Genome DNA was extracted from each cell line every 3 – 4 days after transfection or transduction using DNeasy Blood and Tissue Kit (QIAGEN) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen). 4-week-old NRG mice were injected intra-hepatically using 10 µg of RNA in a maximum volume of 50 µL of PBS+RNA and one week post injection a terminal bleed was performed ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The remaining cells were pelleted at 1000 x g for 10 minutes at 4°C and lysed in 350 µL of Buffer RLT (Qiagen) supplemented with 3.5 µL of 2-β mercaptoethanol (#444203 ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1.5 h in 50 mL conical tubes ...
-
bioRxiv - Biochemistry 2023Quote: A kinome-wide siRNA library that contained 4 individually arrayed siRNA sequences in 384-well plates was purchased from Qiagen. The library consisted of known kinases and associated proteins ...
-
bioRxiv - Microbiology 2023Quote: ... Sample DNA was extracted from microbiome samples using the PowerSoil DNA extraction kit (Cat. No. 12955-4, Qiagen, Valencia, California). Marker genes in isolated DNA were polymerase chain reaction (PCR)-amplified using GoTaq Master Mix (Cat ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...