Labshake search
Citations for Qiagen :
701 - 750 of 1575 citations for 6 Benzyloxy 1H indole 2 boronic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: RNA FISH was performed using a FITC-labeled DNA oligo probe complementary to alpha satellite (Integrated DNA Technologies, Newark, NJ) or a biotinylated locked nucleic acid (LNA) oligo probe complementary to HSATII (QIAGEN, Hilden, Germany) (see Key Resources Table) ...
-
bioRxiv - Molecular Biology 2022Quote: ... hirae V-ATPase was expressed recombinantly in Escherichia coli and purified by affinity purification with a Ni+-NTA (nitrilotriacetic acid) column (Ni+-NTA Superflow; Qiagen, Hilden, Germany). The column was preconditioned with buffer consisting of 50 mM potassium phosphate ...
-
bioRxiv - Bioengineering 2024Quote: ... the extraction of total nucleic acid from transfected MOLT-4 cells (small scale, as described) was performed using a DNeasy Blood and Tissue Kit (QIAgen catalog # 69504) which includes direct lysis with proteinase K treatment ...
-
bioRxiv - Microbiology 2023Quote: The amino acid sequences of coronavirus spike orthologues were subjected to multiple alignment using CLC Workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark). Protein sequence NCBI reference sequences for the indicated viruses are as follows ...
-
bioRxiv - Microbiology 2024Quote: ... The clarified lysate was transferred into the glovebox and loaded onto a gravity column in with 1 mL nickel-nitrilotriacetic acid resin (Qiagen, Hilden, Germany) that was preequilibrated with wash buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2024Quote: Total nucleic acid (DNA and RNA) was extracted from BDB by PowerSoil DNA Isolation Kit or PowerSoil Total RNA Isolation Kit (Qiagen, Hilden, Germany). qPCR was carried out for viral and protozoan pathogens including enterovirus ...
-
bioRxiv - Biophysics 2024Quote: ... The clarified lysate was then applied to a 10 mL bed volume Nickel nitrilotriacetic acid (Ni-NTA) agarose (Qiagen, cat. no. 30230) column ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was then purified by mixing with beads at a 1:0.6 DNA/beads ratio followed by 3 washes with 70% ethanol and eluted with 30 μl of elution buffer (Qiagen Cat# 19086). Whole-exome sequencing was performed using the Mouse_Exome_Targets baitset from the Wellcome Sanger Institute pipeline ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from TG and NTG mice (n=4/group) at 6 months of age using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: Genomic DNA was isolated from all Arabidopsis genotypes at 6 and 9 days after inoculation using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany).
-
bioRxiv - Cancer Biology 2022Quote: ... samples were homogenized using a tissue homogenizer (Brinkmann Instruments, Model PT 10/35, 110 Volts, 6 Amps, 60 Hz) for spleen and thymus while RLT (Qiagen, Hilden, Germany) and hand homogenization was used to isolate BM ...
-
bioRxiv - Cell Biology 2020Quote: ... All HA positive clones were amplified in a 6 well plate and genomic DNA isolated using Qiagen DNAeasy blood and tissue kit as per manufactures instructions (Qiagen, Germantown, MD) (Cat #69504) ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from pooled ipsilateral lumbar (L4-6) DRGs from one rat using the Qiagen RNeasy Mini Prep Kit (Qiagen, Valencia, CA) with on-column DNase digestion (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNAs were prepared from livers of rats subjected to inhalational anesthesia with sevoflurane or desflurane for 6 hours or less than 1 minute using an RNeasy Midi Kit (QIAGEN, Venlo, Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... which were cultivated on a rotary shaker at 37° for 6 h before plasmid isolation using a Midi Kit (Qiagen, Hilden, Germany). The obtained plasmid libraries were subsequently used for electroporation of C ...
-
bioRxiv - Microbiology 2023Quote: ... The MLB and MLBE tubes were then subjected to bead-beating for 6 min using the TissueLyser Lt (Qiagen®, Hilden, Germany), with the instrument set at 50 Hz ...
-
bioRxiv - Cell Biology 2023Quote: ... Key genes involved in the regulation and enzymatic pathways of fatty liver were simultaneously assayed with the RT2 Profiler PCR Array Human Fatty Liver (PAHS-157ZC-6) (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions and analyzed with the Data Analysis Center (QIAGEN Hilden ...
-
bioRxiv - Biochemistry 2022Quote: ... UNC-6 and UNC-40 constructs of various lengths were purified first with Ni-NTA metal-affinity chromatography (QIAGEN, cat. no. 30210) from conditioned media ...
-
bioRxiv - Physiology 2023Quote: Total RNA and miRNA was extracted from liver and distal intestine (n = 6 per condition) using a miRNeasy Tissue/Cells Advanced Mini Kit (Qiagen, Hilden, Germany) following the protocol provided by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... collected into an Eppendorf tube and centrifuged at 11200 rpm at 4 °C for 6 min followed by pellet resuspension with 200 μl of QIAzol (Qiagen, Hilden, Germany). To isolate EC from the bottom layer ...
-
bioRxiv - Physiology 2023Quote: ... proximal intestine and distal intestine (n = 6 per sampling day and diet) according to the miRNeasy Tissue/Cells Advanced Mini Kit protocol (Qiagen, Hilden, Germany). RNA was treated with the Turbo DNA-free kit (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... E17 and P0 (n=6 embryos per sex and time point) using the Qiagen miRNeasy mini kit (CatNo. 217004; Qiagen; Hilden, Germany). 500 ng of total RNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 10 ruddy bowfin and 6 eyetail bowfin (see below) and RNA was extracted from each individual tissue following manufacturer protocols (RNeasy kit; Qiagen, Germantown, MD). RNA was quantified using a NanoDrop 1000 (ThermoFisher ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA from MCF7 cells was isolated by proteinase K digestion at 65°C for 30 minutes followed by purification using the QIAamp circulating nucleic acid kit (Qiagen, Venlo, The Netherlands). Genomic DNA from frozen tissue sections of colorectal liver metastases was isolated using the NucleoSpin Tissue kit according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was then purified using a nucleic acid binding column with on-column DNase treatment (RNase-free DNase set, QIAGEN, Germantown, MD, USA). RNA was then eluted from the column in elution buffer.
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids were extracted at CNM using either QIAamp MinElute Virus Spin (DNA) or QIAamp Viral RNA Mini kits (Qiagen, Germantown, MD, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: Pathway analysis was performed to integrate the targeted amino acid results using the Ingenuity Pathway Analysis Software (IPA) version 70750971 (QIAGEN, Redwood City, USA). Metabolites strongly correlated with tumor weight were identified using Spearman’s rank correlation analysis ...
-
bioRxiv - Bioengineering 2024Quote: ... The clarified supernatant was loaded onto a pre-equilibrated gravity flow column of nickel-nitrilotriacetic acid (Ni-NTA) beads (Qiagen, Germantown, MD, USA). The column was washed with the increasing concentration of imidazole and the recombinant nanobody protein was eluted at a gradient of 250-500 mM imidazole concentration in elution buffer (50 mM Sodium Phosphate ...
-
bioRxiv - Microbiology 2024Quote: ... 140µl of the sample suspension was used to extract total viral nucleic acid using the QIACube QIAamp viral RNA mini kit (Qiagen, Valencia, CA, USA) using the QIACube extraction instrument (Qiagen ...
-
bioRxiv - Biophysics 2024Quote: ... for 30 min at 4 °C before being applied to a 10mL bed volume Nickel nitrilotriacetic acid (Ni-NTA) agarose (Qiagen, cat. no. 30230) column ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...