Labshake search
Citations for Qiagen :
701 - 750 of 4050 citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: SARS-CoV-2 RNA was extracted with QIAamp Viral Mini Kit (Qiagen) in a QIACube extractor or with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... for DNA extraction and (2) RNeasy Mini Kit (Qiagen, cat. no. 74104) for RNA.
-
bioRxiv - Plant Biology 2022Quote: ... Plant material was then homogenised for 2 min in a tissuelyser (Qiagen) using adaptors kept at −70 °C ...
-
bioRxiv - Physiology 2022Quote: ... with 2 cycles in a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 24 Hz for 2 min each ...
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen). Then ...
-
bioRxiv - Immunology 2024Quote: ... 2 × QuantiFast SYBR Green PCR Master Mix kit (QiaGen, Cat No. 204056) was used following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples (2 larvae per tube) were homogenized in a TissueLyser-LT (Qiagen) in 200 μl of the corresponding buffer according to the assay ...
-
bioRxiv - Biochemistry 2022Quote: ... The column was prepared with 2 mL Ni-NTA Agarose Resin (Qiagen). The resin was equilibrated with 10 column volumes of column buffer and resuspended with the supernatant cell extract for 1 h at 4°C with orbital shaking ...
-
bioRxiv - Microbiology 2024Quote: ... Cultures were combined with 2 volumes of RNAprotect® (Qiagen, Manchester, UK) and incubated for 5 mins at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... SK-N-BE(2) cells and iNeurons with an RNeasy kit (Qiagen) using the manufacturer’s protocol including homogenization of samples with QIAshredder spin columns (Qiagen) ...
-
bioRxiv - Biophysics 2024Quote: ... samples were transferred to 2 mL maXtract high density tubes (Qiagen, 129056) and 200 uL of chloroform was added ...
-
Loss of PKCθ-GADD45a axis drives triple-negative breast cancer cells into p53-independent senescencebioRxiv - Cancer Biology 2024Quote: RT2 Profiler PCR Arrays Human Cellular Senescence (PAHS-050ZD-2) from Qiagen were used to identify the gene expression profiles of MDA-MB-436 cells expressing siCtrl or siPKCθ-1 ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μl of media from each of 6 plant wells or media from 3 minimal media wells were pooled and stabilized in RNAprotect® Bacteria Reagent (QIAGEN) before performing RNA extraction using RNeasy Mini Kit (QIAGEN) ...
-
bioRxiv - Genetics 2022Quote: ... and non-inoculated G305-3M leaf segments collected along 10 different time points (0, 3, 6, 9, 12, 16, 24, 36, 48, 72 hpi) using the RNeasy Plant Mini Kit (Qiagen, Germany). The cDNA was synthesized from total RNA using a qScript™ cDNA Synthesis Kit (Quantabio ...
-
bioRxiv - Immunology 2024Quote: Cells were seeded (3 x 105) in 6-well plates and lysed using RLT buffer for RNA isolation (RNeasy Mini kit, Qiagen, #74106). Each sample was performed in triplicate ...
-
bioRxiv - Genetics 2024Quote: Total mRNA was isolated from 6 hpf to 5 dpf zebrafish homogenates using an RNeasy Mini Kit (Qiagen, 74106) and reverse-transcribed with iScript (Bio Rad ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Neuroscience 2020Quote: ... 6b and 6d and the Supplemental Figure 4 we used the RNAeasy Minikit (Qiagen; Cat#74104) following the manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Plant Biology 2024Quote: ... DNA extractions were performed with the MagAttract PowerSoil DNA kit (Qiagen, Cat. No. 27000-4-KF) optimized for the KingFisher™ Flex Purification System (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) or the E.Z.N.A Total RNA kit I (Omega-Biotek) ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 4-day-old Arabidopsis seedlings using RNeasy Plant Mini Kit (Qiagen). For cDNA synthesis ...
-
bioRxiv - Biochemistry 2024Quote: ... for 4 h at 37 °C and purified with PCR purification kit (QIAGEN, catalog no. 28106) per 20 μL IVT reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... genomic DNA was extracted from 4×107 cells using a Puregene Cell Kit (Qiagen Cat#158043). Lentiviral sgRNA inserts were amplified in a two-step PCR using the primers detailed in Supplementary Table 6 ...
-
bioRxiv - Genetics 2024Quote: ... eluted in 4 µl of scPBS and processed following the REPLI-g SC kit (Qiagen, Germany) manufacturer’s guidelines with an incubation time of 2h ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was extracted from 1-to 2-mm-long tail tips using the DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). Genomic DNA (5 μl ...
-
bioRxiv - Cell Biology 2020Quote: ... The qPCR was performed using the TaqMan™ RNA-to-CT™ 1-Step kit (Thermo Fischer Scientific) and was run in a RotorGene-6000-2-plex (Qiagen). PCR conditions having reverse transcription at 48’C for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit, Qiagen Germantown, MD, USA) and ran them in the tissue lyser at either ½ speed or max speed for 30 sec or 1 min ...
-
bioRxiv - Immunology 2022Quote: ... of soluble SARS-CoV-2 WA1 and SARS-CoV-2 Omicron BA.1 spike trimers were isolated from cell supernatants using a Ni-NTA column (Qiagen, Hilden, Germany). Eluents from Ni-NTA purifications were subjected to SEC using a HiLoad Superdex 200 16/600 column followed by a Superose 6 10/300 (Cytiva ...
-
bioRxiv - Microbiology 2023Quote: ... 5.0 x105 293T cells were co-transfected with HIV-1 Env-expressing and HIV-1 Tat-expressing plasmids at a ratio of 1:6 using Effectene (Qiagen) and incubated for 48 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was then purified by mixing with beads at a 1:0.6 DNA/beads ratio followed by 3 washes with 70% ethanol and eluted with 30 μl of elution buffer (Qiagen Cat# 19086). Whole-exome sequencing was performed using the Mouse_Exome_Targets baitset from the Wellcome Sanger Institute pipeline ...
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...