Labshake search
Citations for Qiagen :
701 - 750 of 2828 citations for 3 3 2 3 Dimethyl indol 1 yl 2 hydroxy propylamino propan 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA from untreated or RSL3-treated (with or without 2 hr pre-treatment with 2 µM Ferrostatin-1) MM1S and MM1R cells was extracted using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Frozen tumor cryosections were homogenized with the TissueLyser mixer-mill disruptor (2 x 2 min, 25 Hz, Qiagen, Hilden, Germany). The quality of total RNA was assessed with an Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We carried out four separate extractions from spleen (N=2) and liver (N=2) tissue with MagAttract HMW DNA Kit (QIAGEN). We also performed a fifth extraction with spleen tissue using Monarch® HMW DNA Kit (New England BioLabs ...
-
bioRxiv - Systems Biology 2024Quote: ... K56-2 pcepI-lux and K56-2 ΔcciIR pcepI-lux was extracted using the DNeasy UltraClean Microbial Kit (Qiagen S.r.l). Whole genome shotgun sequencing (2 x 150 bp ...
-
bioRxiv - Genomics 2024Quote: ... Frozen lung cryosections were homogenised with the TissueLyser mixer-mill disruptor (2 x 2 min, 25 Hz, Qiagen, Hilden, Germany). The quality of total RNA was assessed with an Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kit (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: ... Samples were treated with 2 µg RNaseA (Qiagen) and DNA was purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Mm Aldoa 2 FlexiTube siRNA (Qiagen, SI00896238) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... 2 ml of Ni-NTA Agarose (Qiagen, 30310) was added per 50 ml of supernatant and the mix was left on a rolling platform at 4°C overnight ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2) DNeasy Blood and Tissue Kit (Qiagen, Germany); 3 ...
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...
-
bioRxiv - Molecular Biology 2024Quote: ... with Negative Control GapmeR A (30300019-2, Qiagen) using 3.5 μL of Lipofectamine 2000 in Opti-MEM I reduced serum medium following the manufacturer’s suggested protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.5 (Invitrogen #15567027)] in a 2 mL sample tube (Qiagen #990381) and a 5 mm stainless steel bead (Qiagen #69989 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µl of RNAse A (Qiagen; Cat. 19101) and 2 µl DNAse I (Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from the SBMA OL cell model and the control cell model using the RNeasy Mini Kit (Qiagen, Hilden, Germany). The quality and quantity of the RNA obtained were checked using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA from Arabidopsis seedlings (Col-0, sphk1-2, SPHK1-KD and gcs-2) were extracted using RNeasy® Plant Mini Kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... upwards was isolated from two different clones of pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines by using miRNeasy Mini Kit (Qiagen, #79306), following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by RNA extraction with TRIzol using Tissue Lyser II (30 Hz frequency for 2 min with 2 cycles, Qiagen, Germany). Equal amounts of RNA from each sample were reverse transcribed in 20 μl to produce cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using the QIAseq SARS-CoV-2 Primer Panel V2 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using QIAseq SARS-CoV-2 Primer Panel V1 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: Approximately 10 to 20 mg of frozen muscle was homogenized 2 times for 2 minutes at a speed of 30 Hz with a TyssueLyser instrument (Qiagen, Canada) in an ice-cold lysis buffer (1:20 ...
-
bioRxiv - Developmental Biology 2024Quote: ... individual offspring and diet samples were homogenized in 200 µL Optima™ water for 2 x 2 min at 25 Hz using a TissueLyser bead mill (QIAGEN), and then an aliquot of methanol (200 µL ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were homogenized in 300 µL Optima™ water for 2 x 2 min at 25 Hz using a TissueLyser bead mill (QIAGEN). Another 650 µL Optima™ water was added ...
-
bioRxiv - Immunology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM PMSF) on a Ni-NTA resin (Qiagen). Bound proteins were washed (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) containing 0.1% Tween20 (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... the 2 proteases of proteinase K (Qiagen, Hilden, Germany) and dispaseII (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl Qiagen CL buffer (10x; Qiagen, Hilden, Germany), 0.4 µl MgCl2 (25 mM ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) are added to one volume of bacterial culture ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of 100 mg/mL RNase A (Qiagen) was added and the tubes were incubated at 37°C for 15 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... [2] or QIAzol® Lysis reagent (Qiagen, #cat 79306) following vendor’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... and 16.7% (v:v) Proteinase K (Qiagen, 19131, 2 mL). The suspension was then incubated at 37 ℃ for 15 minutes at 500 r.p.m.