Labshake search
Citations for Qiagen :
701 - 750 of 2825 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA from untreated or RSL3-treated (with or without 2 hr pre-treatment with 2 µM Ferrostatin-1) MM1S and MM1R cells was extracted using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We carried out four separate extractions from spleen (N=2) and liver (N=2) tissue with MagAttract HMW DNA Kit (QIAGEN). We also performed a fifth extraction with spleen tissue using Monarch® HMW DNA Kit (New England BioLabs ...
-
bioRxiv - Systems Biology 2024Quote: ... K56-2 pcepI-lux and K56-2 ΔcciIR pcepI-lux was extracted using the DNeasy UltraClean Microbial Kit (Qiagen S.r.l). Whole genome shotgun sequencing (2 x 150 bp ...
-
bioRxiv - Molecular Biology 2024Quote: ... Frozen tumor cryosections were homogenized with the TissueLyser mixer-mill disruptor (2 x 2 min, 25 Hz, Qiagen, Hilden, Germany). The quality of total RNA was assessed with an Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kit (Agilent Technologies ...
-
bioRxiv - Genomics 2024Quote: ... Frozen lung cryosections were homogenised with the TissueLyser mixer-mill disruptor (2 x 2 min, 25 Hz, Qiagen, Hilden, Germany). The quality of total RNA was assessed with an Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kit (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: ... Samples were treated with 2 µg RNaseA (Qiagen) and DNA was purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Mm Aldoa 2 FlexiTube siRNA (Qiagen, SI00896238) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...
-
bioRxiv - Immunology 2023Quote: ... 2 ml of Ni-NTA Agarose (Qiagen, 30310) was added per 50 ml of supernatant and the mix was left on a rolling platform at 4°C overnight ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2) DNeasy Blood and Tissue Kit (Qiagen, Germany); 3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... with Negative Control GapmeR A (30300019-2, Qiagen) using 3.5 μL of Lipofectamine 2000 in Opti-MEM I reduced serum medium following the manufacturer’s suggested protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.5 (Invitrogen #15567027)] in a 2 mL sample tube (Qiagen #990381) and a 5 mm stainless steel bead (Qiagen #69989 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µl of RNAse A (Qiagen; Cat. 19101) and 2 µl DNAse I (Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA from Arabidopsis seedlings (Col-0, sphk1-2, SPHK1-KD and gcs-2) were extracted using RNeasy® Plant Mini Kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... upwards was isolated from two different clones of pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines by using miRNeasy Mini Kit (Qiagen, #79306), following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by RNA extraction with TRIzol using Tissue Lyser II (30 Hz frequency for 2 min with 2 cycles, Qiagen, Germany). Equal amounts of RNA from each sample were reverse transcribed in 20 μl to produce cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using the QIAseq SARS-CoV-2 Primer Panel V2 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using QIAseq SARS-CoV-2 Primer Panel V1 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: Approximately 10 to 20 mg of frozen muscle was homogenized 2 times for 2 minutes at a speed of 30 Hz with a TyssueLyser instrument (Qiagen, Canada) in an ice-cold lysis buffer (1:20 ...
-
bioRxiv - Developmental Biology 2024Quote: ... individual offspring and diet samples were homogenized in 200 µL Optima™ water for 2 x 2 min at 25 Hz using a TissueLyser bead mill (QIAGEN), and then an aliquot of methanol (200 µL ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were homogenized in 300 µL Optima™ water for 2 x 2 min at 25 Hz using a TissueLyser bead mill (QIAGEN). Another 650 µL Optima™ water was added ...
-
bioRxiv - Immunology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM PMSF) on a Ni-NTA resin (Qiagen). Bound proteins were washed (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) containing 0.1% Tween20 (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... the 2 proteases of proteinase K (Qiagen, Hilden, Germany) and dispaseII (Sigma-Aldrich ...
-
bioRxiv - Genomics 2022Quote: ... 2 μl of 100 mg/mL RNase A (Qiagen) was added and the tubes were incubated at 37°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl Qiagen CL buffer (10x; Qiagen, Hilden, Germany), 0.4 µl MgCl2 (25 mM ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) are added to one volume of bacterial culture ...
-
bioRxiv - Neuroscience 2024Quote: ... [2] or QIAzol® Lysis reagent (Qiagen, #cat 79306) following vendor’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... packed with 2 mL Ni-NTA agarose resin (Qiagen) pre-equilibrated with 15 mL lysis buffer ...
-
bioRxiv - Systems Biology 2024Quote: ... and 16.7% (v:v) Proteinase K (Qiagen, 19131, 2 mL). The suspension was then incubated at 37 ℃ for 15 minutes at 500 r.p.m.
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL Ni-NTA resin (Qiagen, Cat. # 30210) was equilibrated with 10 mL of 1X Base buffer and 5 mM β-mercaptoethanol for 10 min by constantly rotating ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sample incubated with 2 NiNTA resin (Qiagen, USA). Protein samples were allowed to bind for 4 hr ...