Labshake search
Citations for Qiagen :
701 - 750 of 3571 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... Frozen liver (∼20 mg) was homogenized in 1 mL of QIAzol (Qiagen 79306) and phase separated after the addition of 200 µL of chloroform ...
-
bioRxiv - Pathology 2024Quote: ... RNA was isolated from passage 1 fibroblasts using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted from 1×106 cells with the RNeasy Mini Kit (Qiagen). Reverse transcription was conducted using Superscript III (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... The supernatant was incubated with 1 ml of Ni-NTA agarose beads (Qiagen) pre-equilibrated in resuspension buffer for 1 hour at 4 °C with gentle rotation ...
-
bioRxiv - Immunology 2024Quote: Lungs were weighed and flash-frozen in 1 mL RNAprotect Tissue Reagent (Qiagen). For RNA isolation ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was isolated from INS-1 cells using RNeasy kit (Qiagen, Germantown, MD) and from islets using TRIzol reagent (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... overnight and purified from a 1% agarose gel (QIAquick Gel Extraction Kit, Qiagen).
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was incubated with 1 mL of Ni-NTA beads (Qiagen, USA) while rotating for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid DNA was extracted from 3-9 positive colonies where possible after blue-white screening using a QIAprep® Spin Miniprep Kit (Qiagen) and sequenced using the standard T7 primer at Eurofins Genomics ...
-
bioRxiv - Genetics 2022Quote: ... and non-inoculated G305-3M leaf segments collected along 10 different time points (0, 3, 6, 9, 12, 16, 24, 36, 48, 72 hpi) using the RNeasy Plant Mini Kit (Qiagen, Germany). The cDNA was synthesized from total RNA using a qScript™ cDNA Synthesis Kit (Quantabio ...
-
bioRxiv - Neuroscience 2023Quote: RNA was isolated from hippocampal tissues of 4- and 9-month-old WT and Tau mice using RNeasy Mini kit from Qiagen with DNase digestion ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Genomics 2024Quote: ... Then the total volume was spun down and plasmid pools were extracted from the bacterial pellets using 2-3 columns of the Hi-Speed Plasmid Maxiprep kit (Qiagen, catalog no. 12663) per sublibrary ...
-
bioRxiv - Microbiology 2021Quote: ... Maize and soybean leaf and root tissue were pulverized for 2-min at a speed of 30 Hz with two 4-mm stainless balls in a TissueLyser II (Qiagen, Venlo, Netherlands). Total DNA was extracted from plant tissues with the OMEGA Mag-Bind Plant DNA Plus kit (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Neuroscience 2020Quote: ... and miR-9/9*-124 + shPTBP2 using TRIzol Reagent in combination with RNeasy mini kit (Qiagen, 74104). RNA quality (RIN > 9.6 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μg of purified RNA was reverse transcribed using RT2 First Strand Kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: NHEKs were transfected at 50-70 % confluency with 1 µL HiPerfect transfection reagent (Qiagen) and 5 nM of either AhR-specific “SilencerSelect” siRNA (s1199 ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was isolated from 1×107 cells with the RNeasy® Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from MDM or THP-1 cells using RNAeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR mix (10 μL) contained 1× Rotor-Gene SYBR green PCR mix (Qiagen), 500 nM each primer ...
-
bioRxiv - Immunology 2021Quote: ... Periplasmic fraction was incubated with 1 mL pre-washed Ni-NTA agarose (30230, Qiagen) for 1 h at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was extracted using the RNeasy kit and treated with DNase 1(Qiagen). Three donor samples of human RPE/choroid were processed for RNAseq ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µL of bisulfite-converted DNA was amplified with HotStar Taq DNA polymerase (QIAGEN) in a 25 µL reaction using the primers designed with MethPrimer [107] and listed in Supplementary Table S2 ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted from 1 million mESCs using DNeasy Blood & Tissue Kit (Qiagen, 69506) and RNA was extracted from 450,000 HEK293T cells using the Direct-zol RNA MicroPrep Kit (Zymo ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from 1 ml of the slurry using a commercial kit (Qiagen).
-
bioRxiv - Neuroscience 2020Quote: ... or its mutants (200 ng) and GCaMP6 (1 μg) using the Effectene reagent (Qiagen). The human orthologue of the mouse splice variant TRPM3α2 in the pCDNA3.1(+ ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μg of RNA was retrotranscribed in cDNA with QuantiTect Reverse Transcription Kit (Qiagen), followed by a PCR amplification of the subsequent transcripts ...
-
bioRxiv - Cell Biology 2021Quote: ... The crude PCR product was gel purified from 1% agarose by spin column (Qiagen), and 200 ng of the purified amplicon were end-labeled using 10 µCi of γ-32P ATP (Amersham ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was prepared from 1 μg RNA using a Quantitect Reverse Transcription kit (Qiagen) and diluted 1:20 in DEPC-treated water ...
-
bioRxiv - Biochemistry 2020Quote: ... but with an anti-His antibody (Qiagen, #34660 at a dilution of 1:5000) as primary ...
-
bioRxiv - Plant Biology 2021Quote: ... swc6-1 and pfd3,5 seedlings (three biological replicates) using RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μg of total RNA was reverse transcribed with Quantitect Reverse Transcription Kit (Qiagen) using oligo(dT) ...
-
bioRxiv - Microbiology 2020Quote: ... served as hosts for derivatives of plasmids pGEX-6P-1 (Cytiva) and pQE30 (Qiagen), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... Each PCR contained 25 µL of 1 × Taq PCR Mastermix (Qiagen GmbH, Hilden, Germany), final concentration of 0.2 µM of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of template DNA and the Qiagen PCR multiplex PCR kit (Qiagen, France) on a T100TM Thermal cycler (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: rhGAA secreted from D532 was purified using 1 mL Ni-NTA agarose resin (Qiagen) according to the manufacturer’s instructions and as described previously [27] with slight modification ...