Labshake search
Citations for Qiagen :
701 - 750 of 963 citations for 2 Trimethylsilyl ethynyl toluene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 32 μl Master Mix containing 30 μl MDA reaction buffer and 2 μl Phi29 polymerase (REPLI-g UltraFast Mini Kit; Qiagen) were added ...
-
bioRxiv - Genomics 2022Quote: ... RNA (3 replicates each of V or E2 treated samples from donor 1 and donor 2) was DNAse treated and cleaned up using the RNeasy Mini kit (Qiagen) or the RNA Clean and Concentrator 5 kit (Zymo ...
-
bioRxiv - Microbiology 2022Quote: ... The tubes were weighed again (wa) after sample collection and the samples were homogenized for 2 min at 25 Hz using a TissueLyser from Qiagen. At 4 d.p.i ...
-
bioRxiv - Plant Biology 2023Quote: Two-week-old Arabidopsis seedlings of Col-0 wild type and trb1/2/3 triple mutans were used for DNA extraction using DNeasy Plant Mini Kit (QIAGEN). A total of 500 ng DNA was sheared with Covaris S2 (Covaris ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was extracted from 2 mm root tips of 5 DAG seedlings using the RNeasy Plus Micro Kit (cat. No. 74034 QIAGEN). Prior to cDNA synthesis ...
-
bioRxiv - Physiology 2022Quote: Assessment of differential expression was conducted on the mapped reads of the 2 previously mentioned pipelines using 2 methods for comparison: the EDGE method with default settings in CLC Genomics Workbench 12 (QIAGEN) and EdgeR (version 3.34.0) ...
-
bioRxiv - Neuroscience 2022Quote: ... Pathway analysis was performed for genes 2-fold up- or down-regulated with p-value < 0.05 using Ingenuity Pathway Analysis (IPA) software (Qiagen, USA).
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 RNA from cell culture supernatant samples was isolated using AVL buffer and the QIAamp Viral RNA Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The mixture was incubated at 16°C for 2 h and the resulting double-stranded DNA was purified using the MinElute PCR Purification kit (Qiagen) with 20μl EB for elution ...
-
bioRxiv - Systems Biology 2022Quote: 2 × 109 cells pretreated with TRIzol reagent were used for preparing RNA reference materials using RNeasy Maxi kit (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... commercially available cDNAs originating from various human tissues were purchased from TaKaRa (detailed sample information is given in Table S3) and 2 ng of cDNA were subjected to quantitative PCR (qPCR) analysis (Rotor-Gene Q, Qiagen), as recommended by the manufacturers ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: SARS-CoV-2 RNA from cell culture supernatant samples was isolated using AVL buffer and the QIAamp Viral RNA Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from 1-2*106 sorted naïve (CD25− CD44lowCD62high) or effector (CD25− CD44highCD62low) CD4+ T-cells using RNeasy Mini Kit (Qiagen Inc.) as described in manufacturer’s protocol including an on-column digestion step (RNaseFree DNase Set ...
-
bioRxiv - Neuroscience 2024Quote: ... with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and TissueRuptor II (Qiagen) homogenization ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 mg of frozen brain was taken per mouse sample and lysed with 0.9 x tissue mass of lysis buffer (1x RIPA buffer with 2% SDS and 2x protease inhibitor cocktail) and was homogenised using a TissueRuptor II (Qiagen). Zebrafish larvae were similarly extracted ...
-
bioRxiv - Plant Biology 2024Quote: ... from infected leaf material or from urediniospores of non-target rust species (Table 2) with the DNeasy Plant mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: Total DNA from enhancer screening library transduced HUDEP-2 cells was isolated using the DNeasy Blood & Tissue kit (Qiagen, 69504) and the enhancer inserts were PCR amplified using the following primers:
-
bioRxiv - Molecular Biology 2024Quote: ... The swabs were removed after heat incubation at 56 °C for 2 hours by transferring samples including swab material to QIAshredder tubes (Qiagen) and centrifugation at 12,000 rcf for 2 min.
-
bioRxiv - Microbiology 2024Quote: ... treated with our LRA panel in the presence or absence of KL-2 was carried out with an RNeasy kit (Qiagen), with the optional on-column deoxyribonuclease I digestion step ...
-
bioRxiv - Neuroscience 2024Quote: ... DRG and paw skin RNA was extracted using a RLT buffer:2-mercapto ethanol mixture in a 100:1 ratio/RNeasy (Qiagen) RNA mini kit according to the manufacturer’s instructions and spinal cord and spleen RNA was extracted using TRizol (Invitrogen)/RNeasy RNA mini kit ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were directly lysed in the well using 350 µL of lysing solution (1% 2-mercaptoethanol in Buffer RLT; RNeasy Mini Kit, 74106, Qiagen) by pipetting over the well ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... The fresh leaf discs were transferred to a 2 mL tube containing a 5 mm stainless steel bead and 500 µL buffer RLT (QIAGEN). The leaf discs were disrupted using a TissueLyser LT (QIAGEN ...
-
bioRxiv - Immunology 2024Quote: ... slides from 25 epidemic KS and 2 endemic KS tumor biopsies and 5 samples of uninvolved skin using the AllPrep DNA/RNA FFPE Kit (QIAGEN). Gene expression analysis was performed on RNA samples on the Nanostring platform (Nanostring Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... 10 Arabidopsis seedlings from the same MS plate were sampled together in 2 mL microtubes containing two 3 mm-diameter tungsten carbide beads (Qiagen), and flash frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Molecular Biology 2023Quote: Bulk-RNA free of genomic DNA for RT-qPCR analysis was extracted from cell pellets (≤ 2 x 106 cells) using the RNeasy plus spin-column purification kit (Qiagen) and performed using the Qiacube liquid handler (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from the root tip (2 cm apex) of the primary root using the RNeasy Plant Mini Kit (QIAGEN). RNA-seq was performed by the Montpellier GenomiX Platform (MGX ...
-
bioRxiv - Pathology 2023Quote: ... DNA was extracted after routine paraffin embedding (2 sections of 20 μm per sample) from 10 canine tumors (DNeasy Blood & Tissue Kit, Cat. No.69504, Qiagen; Veterinary Science Dept ...
-
bioRxiv - Neuroscience 2023Quote: ... ATAC-seq libraries were resolved on 2% agarose gels and fragments ranging in size from 100bp-1Kbp were excised and purified (Qiagen Minelute Gel Extraction Kit – Qiagen Cat#28604) ...
-
bioRxiv - Microbiology 2023Quote: ... samples were transferred from DNA/RNA Shield – Lysis Tube to a 2 ml eppendorf and cells lysed using a TissueLyser II (Qiagen) at maximum speed (5 repetitions of 1 min with 1 min on ice between each) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA and proteins were extracted from fresh or snap-frozen FACS-sorted 2-5 million splenic B cells using AllPrep DNA/RNA/Protein Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Microbiology 2023Quote: ... The homogenate was treated overnight with proteinase K (2 mg/ mL) at 56 °C and DNA was extracted using the MagAttract PowerSoil DNA EP Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mosquito bodies and legs were homogenized in phosphate-buffered saline (PBS) supplemented with 20% FBS and 2% penicillin-streptomycin with 5-mm stainless steel beads with a TissueLyser (Qiagen) before RNA isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Approximately 1 μg of small RNAs in 8.5 μl were incubated with 2 μl of QIAseq FastSelect –rRNA Yeast Kit (Qiagen, #334215) at 75°C ...
-
bioRxiv - Immunology 2023Quote: Purified CD4+FYP+ Treg cells were stimulated with Cell Stimulation Cocktail (eBioscience) for 2 hrs and lysed in RLT buffer (Qiagen) containing 1% 2-mercaptoethanol (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... the eluted DNA samples were run on a 2% agarose gel and the 280bp band purified using the QIAquick Gel extraction kit (QIAGEN). Illumina libraries were generated from 10 ng of DNA ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The supernatant was then purified using a modified PB buffer and eluted using 2 washes in 18 μl buffer EB (QIAGEN) - with 3 min of incubation time at 37°C (Dabney et al ...
-
bioRxiv - Genetics 2023Quote: ... Whole blood was collected in 2% SDS Queens lysis buffer [23] and genomic DNA was extracted using a DNeasy Blood & Tissue Kit (Qiagen). All research was approved by the Institutional Animal Care and Use Committee at Columbia University (AC-AAAW6451) ...
-
bioRxiv - Genomics 2023Quote: ... to the eluted samples and digestion was carried out for 2 hours at 55°C followed by PCR purification (Qiagen). Sequencing libraries were prepared using the NEBNext Ultra II DNA Library Preparation Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Microbiology 2023Quote: RNA was isolated from 2 h and 10 h RPMI-grown and macrophage-internalized Cg cells using the RNeasy kit (Qiagen), followed by DNase I digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... gDNA wipeout buffer was used to remove Genomic DNA for 2 minutes at 42°C and cDNA was synthetized with the QuantiTect Reverse Transcription Kit (Qiagen). qPCR was performed with PowerUp SYBR Green Master Mix using the StepOnePlus Real-Time PCR system ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2023Quote: ... Crystals were grown at 30°C by the hanging drop vapor diffusion method using 2 μL sample drops and 300 μL crystallization solution in a sealed chamber (EasyXtal 15-Well Tool, Qiagen). Crystals were soaked for 1h (for the Na structure or with the dibromo Intronistat B derivative ...