Labshake search
Citations for Qiagen :
651 - 700 of 737 citations for Recombinant Human CEACAM1 His tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: Total RNA from post-mortem adult human neural retina was extracted following manufacturer’s guidelines (RNeasy Mini kit®, Qiagen) followed by DNase treatment (ArcticZymes ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from FFPE MCF7 and human tumor tissue specimens using the QIAamp DNA FFPE Tissue kit (Qiagen). DNA was quantified using Qubit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA (200 ng) was used for quantitative PCR with the Human Cellular Senescence RT2 Profiler™ PCR Array (Qiagen) containing 84 key genes involved in the initiation and progression of the biological process causing cells to lose the ability to divide ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted from the cell pellets of human primary male and female PT cells using the RNAeasy Mini Kit (Qiagen). After quantifying RNA concentration in a Nanodrop instrument (Thermo) ...
-
bioRxiv - Genetics 2020Quote: ... Analyses of HTT CAG repeat size in both HttQ111 mice and in patient fibroblasts was performed by PCR using human-specific HTT primers and Taq PCR Core Kit with Q solution (Qiagen), as previously described (17 ...
-
bioRxiv - Bioengineering 2020Quote: ... The prepared cDNA was preamplified using the RT2 PreAMP Primer Mix for Human and Mouse PCR Array (Qiagen, PBH-181Z). cDNA was analyzed by RT-qPCR using a Qiagen RT2 profiler custom panel (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... was used for human ISG15 and ISG56 and mouse genes including Gapdh as the housekeeping gene on the Rotor-Gene Q 5plex (Qiagen). RT-qPCR primers and probes are listed in the supplementary table 2.
-
bioRxiv - Microbiology 2021Quote: ... mRNA-Seq FASTQ reads were mapped to the human reference genome (Homo sapiens v81; hg38) using default options on CLC Genomics Workbench 11 (Qiagen). Total gene reads (with at least 1 read count ...
-
bioRxiv - Genomics 2020Quote: RNA isolation for all the 248 human subjects were performed using QIAamp Viral RNA Mini Kit (Qiagen, Cat. No. 52906). The isolated RNA was subjected to qPCR for determining viral load by Ct values ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from human fibroblasts as well as iNs from the same lines using the miRNeasy kit (Qiagen) followed by Universal cDNA synthesis kit (Fermentas) ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 ng of genomic DNA derived from sorted neuronal and non-neuronal nuclei of a postmortem human ACC sample (Brain A) was used for bisulfite conversion (EpiTect Bisulfite Kit, Qiagen). For each sample ...
-
bioRxiv - Cancer Biology 2021Quote: RNA/DNA was isolated from the macro-dissected xenografts (injected/contralateral side, separately) and human GBM (AllPrep DNA/RNA Mini Kit, Qiagen). The ratio of human/mouse cells in the xenografts was estimated by species specific PCR (DNA ...
-
bioRxiv - Developmental Biology 2022Quote: RNA samples from freshly thawed human primary hepatocytes (SMC and AQL) or from PSC-hepatocytes were prepared with RNeasy plus micro kit (Qiagen), and 10-20 ng total RNA samples were used for constructing stranded RNA libraries with Swift RNA-seq library preparation kit and sequenced with an Illumina HiSeq 2500 sequencer with 50 base single end reads.
-
bioRxiv - Microbiology 2022Quote: ... Initial gene expression profiling was performed using the 96-well Human Cytokines & Chemokines RT2 Profiler PCR Array (PAHS-150ZC, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Bioengineering 2020Quote: Total DNA samples were obtained from human skin biopsy samples (XX, caucasian, 79 yr) using the QIAamp DNA Mini Kit (Qiagen) and applied to the human Illumina Infinium EPIC 850K chip ...
-
bioRxiv - Microbiology 2021Quote: ... RNA-seq FASTQ data were processed and mapped to the human reference genome (hg38) with the CLC Genomics Workbench 20 (Qiagen). Differential gene expression was analyzed with the DESeq2 package in R (Drummond et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and gene expression was assessed using RT2 Profiler PCR Array Human WNT Signaling Pathway Plus (PAHS-043YC-2, Qiagen Germany). Arrays were run on QuantStudio6 (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen, Catalog#:PAHS-019ZA) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was extracted from the sorted cells according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN). After pelleting by centrifugation for 5 minutes at 5,000 x g ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: RNA from human M1 macrophages transfected with SP140 siRNA or scrambled siRNA was extracted using a RNeasy mini-kit (Qiagen). 150 ng total RNA was labelled using the cRNA labelling kit for Illumina BeadArrays (Ambion ...
-
bioRxiv - Biochemistry 2022Quote: ... high molecular weight genomic DNA (gDNA) was purified from human primary T cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... RNA was also extracted from human first and second trimester placental villi using the RNeasy Plus Universal Mini Kit (Qiagen). Libraries were made using the Illumina TruSeq Stranded mRNA Library Kit according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Gene expression of 84 heat shock genes in mock-infected or 229E-infected cells was analyzed using Human Heat Shock Proteins & Chaperones RT2 Profiler PCR array (Qiagen). Real-time PCR analyses were performed with specific primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... We designed species specific MALAT1 tiling primers for human and green monkey (Table S1) and performed multiplex PCRs following Qiagen Multiplex PCR protocol (Qiagen). cDNA was divided equally between primer sets ...
-
bioRxiv - Bioengineering 2022Quote: qRT-PCR of SARS-Cov-2 RNA was performed as previously described.59 RNA was extracted from human lung epithelial cells expressing human ACE2 (A549-hACE2) grown in 96-well plates by using the RNeasy 96 Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted from newly acquired human embryonic/fetal brain samples (n=32) using the AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Cell Biology 2024Quote: Total RNAs were extracted from human benign prostatic cells using RNeasy Mini Kit as per manufacture’s protocol (Qiagen, Cat # 74104). cDNA was synthesized using 2µg of RNA using a high-capacity RNA to cDNA kit (applied biosystems ...
-
bioRxiv - Physiology 2023Quote: ... total RNA from normal human or AIL patient neutrophils was isolated using RNeasy Total RNA Isolation Kit (Qiagen, GmBH, Germany)/ TRIzol reagent (Life technologies ...
-
bioRxiv - Physiology 2023Quote: Cytokines secreted from nonapoptotic and apoptotic NCTC cells were screened with the Human Inflammatory Cytokines Multi-Analyte ELISArray Kit (QIAGEN). Nonapoptotic and apoptotic NCTC cell supernatants were prepared in replicate serial dilutions of the Antigen Standard ...
-
bioRxiv - Immunology 2023Quote: Real-time quantitative PCR (RT-qPCR) was done as previously described [Zonneveld 2021] using the Human T cell Tolerance & Anergy RT2 Profiler PCR array (Qiagen). The relative expression levels of each gene were normalized using 4 reference genes (B2M ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted from sorted cells and from two replicated of in vitro cultured E-A14 cells stabilized in RLT buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Micro Kit (Qiagen). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: Investigation of the cell cycle related genes in LoVo cell line on treatment with FA FOS I was performed as described above by using the synchronized and 24 h FA FOS I (198 µg/ml) treated cells profiled by using RT2 Prolifer PCR Array- Human Cell cycle from Qiagen. The data was analysed by using Gene globe platform and reactome pathway analysis.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: Genomic DNA was extracted from sub-dissected samples of human post-mortem brain tissue using Qiagen’s DNeasy Blood & Tissue Kit (Qiagen, UK). All samples were genotyped on the Illumina Infinium Omni1-Quad BeadChip and on the Immunochip ...
-
bioRxiv - Neuroscience 2024Quote: ... in vitro hTAM were incubated for 6 hours at 37°C with predesigned siRNA against human SPP1 (Qiagen, cat.#1027416) or Scramble (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: Total RNA was collected from human or murine primary spinal cord astrocytes following media or cytokine treatment using an RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions and measured with a NanoDrop One spectrophotometer (Thermofisher) ...
-
bioRxiv - Microbiology 2024Quote: ... Mouse GAPDH or human actin mRNAs were used as a reference and detected by QuantiTect primer assay (GAPDH; QT01658692, Actin; QT01680476, Qiagen) and the qPCRBIO SyGreen mix Hi-ROX (PCR Biosystems) ...
-
bioRxiv - Immunology 2024Quote: GM-MØ (1 × 106 cells) were transfected with a human GSK3A-specific and/or GSK3B-specific siRNA (50 nM) (Dharmacon) using HiPerFect (Qiagen). Silencer Select Negative Control No ...
-
bioRxiv - Neuroscience 2024Quote: ... The procedure started by cryogrinding approximately 200 mg of human brain tissue and isolating total RNA using a Maxi Prep kit (Qiagen). The RNA quality and quantity was assessed by Agilent TapeStation ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from both non-irradiated (proliferative) and irradiated (senescent) human DMG cells using the Rneasy Micro kit (Qiagen). Total RNA integrity was validated using Agilent’s 4200 Tapestation ...
-
bioRxiv - Cell Biology 2024Quote: RNA was extracted from normal human epidermal KCs or cultured HaCaT cells using the RNeasy Mini kit (Qiagen, Hilden, Germany). cDNA was prepared using the SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted from mouse (NPsh-1-IDH2WT, NPsh-1-IDH2R172K) and human cells (RBE) with the RNAeasy extraction kit (Qiagen). Bulk RNA-SEQ of NPsh-1-IDH2WT ...
-
bioRxiv - Genetics 2024Quote: Total RNA was extracted from the post-mortem adult human neural retina samples using the RNeasy Mini kit® (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... A Qiagen RT2 SYBR Green master mix with validated qPCR human primers (for HUVECs and BeWo) or mouse primers (for N27 cells) from Qiagen (Frederick) were used to determine relative magnitudes of gene-expression levels using RT-PCR ...