Labshake search
Citations for Qiagen :
651 - 700 of 1020 citations for Recombinant Human CASP14 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... total RNA from normal human or AIL patient neutrophils was isolated using RNeasy Total RNA Isolation Kit (Qiagen, GmBH, Germany)/ TRIzol reagent (Life technologies ...
-
bioRxiv - Immunology 2023Quote: Real-time quantitative PCR (RT-qPCR) was done as previously described [Zonneveld 2021] using the Human T cell Tolerance & Anergy RT2 Profiler PCR array (Qiagen). The relative expression levels of each gene were normalized using 4 reference genes (B2M ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted from sorted cells and from two replicated of in vitro cultured E-A14 cells stabilized in RLT buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Micro Kit (Qiagen). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: Investigation of the cell cycle related genes in LoVo cell line on treatment with FA FOS I was performed as described above by using the synchronized and 24 h FA FOS I (198 µg/ml) treated cells profiled by using RT2 Prolifer PCR Array- Human Cell cycle from Qiagen. The data was analysed by using Gene globe platform and reactome pathway analysis.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from whole lungs from IAV non-infected / infected mice and human PBMCs using (RNeasy mini kit, Qiagen). RNA quantity and purity were assessed using a spectrophotometer (NanoDrop) ...
-
bioRxiv - Neuroscience 2024Quote: Genomic DNA was extracted from sub-dissected samples of human post-mortem brain tissue using Qiagen’s DNeasy Blood & Tissue Kit (Qiagen, UK). All samples were genotyped on the Illumina Infinium Omni1-Quad BeadChip and on the Immunochip ...
-
bioRxiv - Biophysics 2020Quote: ... Proteins were purified by immobilized metal affinity chromatography according to the manufacturer’s protocol (Qiagen), followed by gel filtration in 50 mM sodium citrate buffer (pH 5.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The proteins were first purified by chromatography on a Ni-NTA agarose column (QIAGEN), and then further purified on a HiTrap Heparin column (GE Healthcare) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were digested with 30 μL of Proteinase K II (QIAGEN, GmbH, Hilden, Germany). DNA was washed with AW1 and AW2 buffers (QIAGEN ...
-
bioRxiv - Biophysics 2019Quote: ... The protein present in the supernatant was purified using a Ni-NTA column (Qiagen). The protein was eluted by increasing the concentration of imidazole ...
-
bioRxiv - Biochemistry 2019Quote: ... proteins were blotted onto PVDF membrane and examined with an RGS-His4-antibody (Qiagen) and a 1:2500 dilution of the fluorophore-conjugated secondary antibody Cy3 (ECL Plex goat-α-mouse IgG-Cy3 ...
-
bioRxiv - Biochemistry 2020Quote: ... The target proteins were purified by affinity chromatography using a Ni-NTA column (Qiagen) with the lysis buffer supplemented with 20 mM and 200 mM imidazole serving as the washing buffer and elution buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... The soluble hEKL proteins were purified using a Ni-NTA agarose resin (Qiagen, Germany) and subsequently HiLoad 16/60 superdex 75 prep grade column (GE Healthcare ...
-
bioRxiv - Bioengineering 2020Quote: ... The soluble protein fraction was then purified with pre-equilibrated Ni-NTA resin (Qiagen), recovered in elution buffer (100 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was purified by affinity chromatography using Ni-NTA agarose (Qiagen, Hilden, Germany), followed by gel filtration chromatography ...
-
bioRxiv - Cell Biology 2021Quote: ... We purified the 6xHIS fusion protein on nickel-nitrilotriacetic acid agarose (Qiagen, Valencia, CA) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM 2-mercaptoethanol) and the proteins eluted from nickel-NTA agarose beads (Qiagen; using buffer containing 25 mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Biophysics 2022Quote: ... The YB-1 (1-180) protein fragment was purified following the manufacturer’s recommendations (Qiagen). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... tularensis IM protein SecY (Huntley, 2007) or the Penta-His HRP conjugate antibody (Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... and proteins were purified by IMAC using Ni-NTA spin columns (QIAGEN, Hilden, Germany). Proteins were eluted in 100 μL elution buffer (50 mM sodium phosphate pH 8.0 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Uncleaved protein with 6xHisTag were isolated from the lysate using Ni-NTA resin (Qiagen). The flow-through (FT ...
-
bioRxiv - Biophysics 2019Quote: ... Proteins were purified by immobilized metal affinity chromatography according to the manufacturer’s protocol (Qiagen), followed by gel filtration in 10 mM sodium phosphate buffer (pH 7.4 ...
-
bioRxiv - Bioengineering 2019Quote: ... The secreted protein was purified from the supernatant using Ni-NTA agarose resin (Qiagen) as previously described46 ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged proteins were incubated with Nickel-nitrilotriacetic acid (NTA) sepharose (Qiagen, Hilden, Germany) at 4°C with slight shaking for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... His-βC1 fusion proteins were purified using Ni-nitrilotriacetate (Ni-NTA) agarose (Qiagen, 30210) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... His-tagged proteins from the supernatant were incubated overnight with Ni-NTA agarose (Qiagen) at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Network analysis of identified proteins was then performed using Ingenuity Pathway Analysis software (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: ... and associated protein network by using Ingenuity® Pathway Analysis (IPA) software (QIAGEN Inc.), relying on IPA’s proprietary algorithm to evaluate and minimize sample source bias ...
-
bioRxiv - Physiology 2021Quote: ... Total RNA was extracted from EVs (20 μg protein) using miRNeasy Mini Kit (Qiagen). RNA was then reverse-transcribed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... The proteins were purified by affinity chromatography using a Ni-NTA agarose resin (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... The secreted protein in the culture supernatant was purified using Ni-NTA agarose (Qiagen) according to the manufacturer’s protocol and dialyzed against PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were equalized for protein concentration and incubated with NiNTA agarose beads (Qiagen, #L30210) for O/N ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was purified using Ni-NTA agarose beads according to the manufacturer’s instructions (Qiagen). A buffer exchange was performed by centrifugation of the protein preparation through an Amicon Ultra-15 centrifugal filter unit (Millipore ...
-
bioRxiv - Bioengineering 2020Quote: ... The enriched proteins were searched again Ingenuity pathway analysis (QIAGEN, Redwood City, CA, USA) for their primary subcellular location and enriched molecular functions ...
-
bioRxiv - Immunology 2024Quote: ... Proteins were purified from filtered supernatants using nickel nitriloacetic acid (Ni-NTA) agarose (QIAGEN) via gravity flow ...
-
bioRxiv - Microbiology 2024Quote: ... Soluble protein fractions were then mixed with pre-equilibrated Ni-NTA agarose resin (Qiagen) and incubated at 4°C for 1 h with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... Bacteria isolates then underwent DNA isolation using AllPrep Bacterial DNA/RNA/Protein Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins harboring the His6 tag were captured by incubation with Ni- NTA resin (Qiagen) (2ml resin per bacterial lysate from 1L culture ...
-
bioRxiv - Neuroscience 2023Quote: ... significantly differentially expressed proteins from all translatomes were analysed for IPA pathway analysis (Qiagen) to highlight activated/inhibited pathways when comparing control (NBH ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were eluted using Ni-NTA spin columns according to the manufacturer’s protocol (Qiagen). GST-α synuclein fusion protein tagged at the N-terminus was obtained from Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: Total cellular RNA was extracted using AllPrep DNA/RNA/Protein mini kit (Qiagen, UK). Reverse transcription was carried out using kits from Invitrogen following the manufacturer’s instructions (SuperScript First-Strand Synthesis System for RT-PCR) ...
-
bioRxiv - Biochemistry 2023Quote: ... His-tagged proteins were purified by affinity chromatography on Ni-NTA Agarose resin (Qiagen) and eluted with buffer containing 0.5 M imidazole ...
-
bioRxiv - Neuroscience 2023Quote: ... and day 7,14,21 and 28 of maturation using AllPrep DNA/RNA/Protein (80004, Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: Total protein was extracted from snap frozen tissues with a Tissue Lyser II (Qiagen) using 5mm Bead Beater balls (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was then isolated with Qiagen AllPrep DNA/RNA/Protein Mini Kit (Qiagen # 80004). Breast microstructures from 5 independent donors were exposed to vehicle (PBS and PBS plus DMSO) ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining protein mixtures were incubated with 50 μL Ni-NTA agarose beads (QIAGEN) at 4℃ for 1.5 h with constant rotation ...
-
bioRxiv - Microbiology 2023Quote: ... the proteins were purified by affinity chromatography with Ni-NTA superflow affinity column (Qiagen) as previously described (33).
-
bioRxiv - Bioengineering 2020Quote: ... A Qiagen RT2 SYBR Green master mix with validated qPCR human primers (for HUVECs and BeWo) or mouse primers (for N27 cells) from Qiagen (Frederick) were used to determine relative magnitudes of gene-expression levels using RT-PCR ...