Labshake search
Citations for Qiagen :
651 - 700 of 1933 citations for Mouse ANKRA2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Plasmid DNA was purified using QIAprep Spin Miniprep kit (QIAGEN) and sequenced to verify successful mutagenesis.
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (Qiagen) and the integration of the oligonucleotides pairs was assayed using Bbs1 digestion (plasmids with putative correct integrations remained circular following the enzymatic digestion) ...
-
bioRxiv - Immunology 2021Quote: ... or the endotoxin-free HiSpeed Plasmid Midi Kit (Qiagen 12643). All DNA extracts were quantified using UV spectrophotometry (NanoDrop™ -Thermo Scientific).
-
bioRxiv - Developmental Biology 2020Quote: ... Plasmids were isolated with the QIAprep Spin Miniprep Kit (Qiagen) following the instructions of the Quick-Start Protocol using a centrifuge for processing ...
-
bioRxiv - Genetics 2020Quote: ... Plasmid DNA was extracted using QIAprep Spin Miniprep Kit (Qiagen). Standard procedures were used to perform routine cloning.
-
bioRxiv - Biophysics 2021Quote: ... was prepared using the EndoFree Plasmid Maxi Kit (Qiagen, France). For FRET-FLIM experiments ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids were extracted using anendotoxin-free kit (QIAgen Cat. #12362) and stored until ready to use.
-
bioRxiv - Developmental Biology 2022Quote: ... Plasmid DNA purification used an ultrapure DNA purification kit (Qiagen). BAC plasmid DNA was digested with Not I before analysis by pulse-field gel electrophoresis (Osoegawa et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid was isolated using QIAprep Spin Miniprep Kit (Qiagen 27104). All plasmids were sent to the Penn Genomic Analysis Core for sgRNA insertion validation by Sanger sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... the plasmid was extracted using a commercial extraction kit (Qiagen) and used to transform electrocompetent E ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli (DH5α) and purified using the Plasmid Maxi Kit (Qiagen). Site-directed mutagenesis was used to introduce single nucleotide variants into the generated construct ...
-
bioRxiv - Genetics 2022Quote: ... and purified with the HiSpeed Plasmid Maxi Kit (#12663, Qiagen). Transient transfection was carried out in HEK293T cells transfected with 1 μg of plasmid DNA in the presence of X-tremeGene9 DNA transfection reagent (#6365809001 ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: ... Plasmids were extracted using the QIAGEN Miniprep kit (27106, QIAGEN) as per manufacturers’ instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated using spin columns (Qiagen Spin Miniprep Kit). The resulting plasmids were checked by Sanger sequencing ...
-
bioRxiv - Immunology 2022Quote: ... All plasmids were prepared using QIAprep mini spin columns (QIAGEN), and sequences were verified by Sanger sequencing using an ABI3770.
-
bioRxiv - Molecular Biology 2023Quote: ... then purified with QIAGEN Plasmid Plus Midi Kit (QIAGEN, 12943). Mutations were confirmed by sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (QIAGEN), and individual clones were sequenced at Microsynth using the IRES-rev primer (TATAGACAAACGCACACCG) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The plasmids of these colonies were purified via miniprep (Qiagen) and sequenced by SNPsaurus ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids and DNA fragments were purified using commercial kits (Qiagen). Elim Biopharmaceuticals synthesized custom oligonucleotides and provided Sanger DNA sequencing services.
-
bioRxiv - Synthetic Biology 2023Quote: ... The plasmids of these colonies were purified via miniprep (Qiagen) and sequenced by SNPsaurus ...
-
bioRxiv - Immunology 2023Quote: ... The plasmids were purified using QIAprep Spin Miniprep Kit (Qiagen), and their sequences were confirmed by Sanger sequencing (Genewiz) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Vectors were isolated using the plasmid miniprep kit (Qiagen, Germany). pURR expression vectors were transformed into E ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid libraries were recovered using a Midi prep kit (Qiagen). Lentiviral libraries were generated in HEK293T by transfection of plasmid libraries using lipofectamine 2000 (ThermoScientific ...
-
bioRxiv - Genomics 2023Quote: ... plasmids miniprepped with the QIAprep® Spin Miniprep Kit (QIAGEN) and sequenced on both strands using pJET1.2 primers.
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid DNA was prepared using the Mini Prep kit (Qiagen). Transgenic animals expressing an extrachromosomal array were created by gonadal microinjection of plasmids of interest with indicated co-injection marker into indicated strains in Table S6 ...
-
bioRxiv - Developmental Biology 2023Quote: Plasmids were purified using a MaxiPrep DNA isolation Kit (Qiagen). For virus packaging ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (QIAGEN), and individual clones were sequenced at Microsynth using a forward primer (GGCAAACAACAGATGGCTGGCAAC ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids were amplified with the QIAprep Spin miniprep kit (Qiagen) and linearized with Not1-HF (New England Biolabs) ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids were isolated using a bacterial miniprep kit (Qiagen, 27106). Nanobody sequences were determined by Sanger sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... plasmids were extracted using a QIAprep Spin Miniprep Kit (QIAGEN) and the correct sequences were confirmed by Sanger sequencing.
-
bioRxiv - Cancer Biology 2023Quote: ... NR0B2 overexpressing plasmid was delivered using Effectine transfection reagent (Qiagen). All transfections were conducted in accordance with the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Plasmids used for protein purification were based on pQE70 (Qiagen). For purification of EsaDEG ...
-
bioRxiv - Genomics 2023Quote: ... coli cultures using the EndoFree Plasmid Maxi Kit (Qiagen #12362). Low passage number (≤ passage 10 ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA was extracted using a Qiagen plasmid mini kit (Qiagen). Confirmation of the correct constructs was performed with Sanger Sequencing via Azenta/GENEWIZ (Azenta Life Sciences Inc.).
-
bioRxiv - Neuroscience 2023Quote: ... 16 µg of plasmid and 15 µL of Effectene (Qiagen). Cells were collected after 48 hours and prepared for the RNA-IP experiment ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the plasmid as per instructions and isolated by QIAGEN HiSpeed Plasmid Midi Kit (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were extracted using QIAprep Spin Miniprep Kit (27106, Qiagen) and transformed into competent MG1655.
-
bioRxiv - Genomics 2023Quote: ... Plasmid DNA (pDNA) was prepared (QIAprep Spin Miniprep Kit, Qiagen). Purified plasmids were sequence confirmed by restriction enzyme digests and whole plasmid sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... Linearized plasmid was purified using Qiaprep Spin Miniprep Kit (Qiagen). For T7-based in vitro transcription ...
-
A CRISPR activation screen identifies FBXO22 as an E3 ligase supporting targeted protein degradationbioRxiv - Biochemistry 2023Quote: ... The construct library was extracted using plasmid Maxi kit (Qiagen).
-
bioRxiv - Bioengineering 2023Quote: ... Plasmid- and DNA-gel extractions were done with kits (Qiagen) as per manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid DNA was isolated using QIAprep miniprep kit (Qiagen, Germany). All constructs were confirmed by sequencing ...
-
bioRxiv - Genetics 2024Quote: ... Plasmids were sequence verified and purified with midi prep (Qiagen). Plasmids with gRNA vectors were sent for injection (completed by Genome Prolab Inc ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid DNA was isolated using QIAprep Spin Miniprep Kit (Qiagen) or Nucleospin Plasmid Kit (Macherey-Nagel) ...
-
bioRxiv - Neuroscience 2024Quote: ... QIAfilter Plasmid kits (Midi prep kit; Qiagen; catalog no.: 12243) were utilized to purify plasmid DNAs following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmids were purified using a QIAprep Spin Miniprep kit (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were purified using the Spin MiniPrep kit (Qiagen 27104) per manufacturer’s instruction with the following modification for S ...
-
bioRxiv - Molecular Biology 2024Quote: ... and midi-prepped using a Plasmid Plus Midi kit (Qiagen) per manufacturer’s instructions ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Plasmids were then obtained using a Qiagen MiniPrep Kit (Qiagen). Plasmids were assessed for the desired sequence by Sanger sequencing and transformed into P ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Plasmid DNAs were purified using the Qiaprep spin Miniprep (Qiagen) and verified by Sanger sequencing using internal gene-specific and vector primers to ensure overlapping sequence information in both forward and reverse directions ...