Labshake search
Citations for Qiagen :
651 - 700 of 10000+ citations for Cow Four And A Half LIM Domains Protein 2 FHL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 80 µl of Viral Transport Media that had previously stored a nasopharyngeal swab from a patient infected with SARS-CoV-2 were used for RNA isolation using the QIAamp Viral RNA Mini spin kit (Qiagen, Cat No./ID: 52904) according to manufacturer specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... Both the input and IP samples were incubated at 50°C for 2 hr and then cleaned up using the Qiaquick PCR Purification Kit (Qiagen, Hilden, Germany, Cat # 28104) and eluted in 35 μL of water.
-
bioRxiv - Systems Biology 2019Quote: RNA was extracted from a total of 17 samples from Experiment 2 with the AllPrep PowerFecal DNA/RNA Kit (Qiagen USA, Cat. No. 80244). The 17 samples included 7 target samples taken during antibiotic treatment (4 untreated and 3 non-responder ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted from the remaining 2 mL of the cell suspension using the RNeasy® Protect Bacteria Mini Kit (QIAGEN, Cat. No. 74524) following the manufacturer instructions.
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was isolated from bulk HSPC samples (∼2 x 106 cells per sample) using a QIAGEN Blood & Tissue DNA isolation kit (QIAGEN, Inc., Germantown, MD, USA) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was precipitated in 80% ethanol and Automated Protein-Aggregation Capture (PAC) was performed on a BioSprint-96 (Qiagen) according to the following method ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas3d and Cas10d proteins were purified from HEK293T cells expressing each His-tagged Cas protein using Ni-NTA agarose (Qiagen) and a gel filtration column (Superdex 200 increase 10/300 GL columns) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were purified using Ni-NTA agarose (Qiagen) and eluted using 300 mM imidazole in purification buffer ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were purified with Ni-NTA beads (Qiagen). Proteins and beads were washed 3 times with protein purification lysis buffer before incubating the beads with elution buffer (400 mM imidazole in protein purification lysis buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein was purified using Ni-NTA agarose (Qiagen) eluting with 300 mM imidazole ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Proteins were purified with Ni-NTA Resin (Qiagen) using standard protocols ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were purified using Ni-NTA agarose (Qiagen) resin first ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein Center (Thermo) and Ingenuity Pathways Analysis (Qiagen). For protein center analysis ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Proteins were purified on Ni-NTA resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The proteins were purified using Ni-NTA (Qiagen), and the His tag was cleaved by the Tev protease ...
-
bioRxiv - Immunology 2023Quote: ... Proteins were purified using Ni-NTA agarose (QIAGEN), followed by size-exclusion chromatography using HiLoad 16/600 Superdex200 columns (GE Healthcare Life Sciences) ...
-
bioRxiv - Microbiology 2023Quote: ... SrtC2 protein was purified using Ni-NTA (Qiagen) affinity chromatography with the addition of 5 mM β-mercaptoethanol in all buffers ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins were affinity-purified with NiNTA agarose (Qiagen). The eluate was further purified over a Source 15 Q column (Cytiva) ...
-
bioRxiv - Genomics 2021Quote: Amplicon libraries for viral genome sequencing were prepared using QIAseq FX DNA Library Kit and QIAseq SARS-CoV-2 Primer Panel (Qiagen, cat. no. 180475, cat. no. 333896) as instructed by the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2019Quote: ... and the 6xHis-SUMO tagged proteins were purified from the soluble protein fraction after centrifugation using an Ni2+-NTA Superflow column (Qiagen, Venlo, Netherlands). Next ...
-
bioRxiv - Cancer Biology 2021Quote: The recombinant hexahistidine-tagged TNC-C and EDB WT and mutant proteins (at 60 μg of protein / 40 μl beads in PBS) were immobilized to Ni-NTA Magnetic Agarose Beads (QIAGEN, Hilden, Germany) at RT for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... His-tagged proteins were purified on NiNTA beads (Qiagen). Purified proteins were eluted with 500 mM NaCl ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were purified with Ni-NTA affinity resin (Qiagen). The aminoacylation assay protocol from Jiongming Lu was then followed (Lu et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein were purified using Ni-NTA agrose (Qiagen, 30210) according to the manufacturer’s manual ...
-
bioRxiv - Biochemistry 2021Quote: ... Soluble protein was mixed with Ni-NTA resin (Qiagen) for 1h at 4 degrees on a nutator ...