Labshake search
Citations for Qiagen :
651 - 700 of 3255 citations for 7 bromo 1 methyl 1 3 dihydro 2H benzo d imidazol 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... Transfection into C2C12 or MCF-7 cells utilized a lipid-based reagent (Fast-forward protocol, Effectene reagent, Qiagen). As a reference for transfection efficiency ...
-
bioRxiv - Plant Biology 2023Quote: ... The grinding was done using 7 mm stainless steel beads with TissueLyser II bead mill (Qiagen, Hilden, Germany), 2 minutes totally at 25 Hz ...
-
bioRxiv - Immunology 2023Quote: ... cytometry-sorted 7-AAD- CD45+CD11b+F4/80+ cells were lysed in 350µL RLT lysis buffer (Qiagen, 79216). At 4 days post injury ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Cancer Biology 2023Quote: ... Resuspend the cells in 10 ml of suspension buffer (10 mM EDTA pH8.0, 150 mM NaCl, 1% glycerol, Lysis blue (1×, from QIAGEN Plasmid Plus Midi Kit), RNase A (0.55 mg/ml) ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from the VTM in a biosafety level-3 (BSL-3) laboratory using QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and 18S rRNA (5’-GAG CGA AAG CAT TTG CCA AG-3’ and 5’-GGC ATC GTT TAT GGT CGG AA-3’) on a Roter-Gene Q (Qiagen, Hilden, Germany) with 2x AmpiGene® qPCR Green Mix Lo-ROX (Enzo Biochem ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...
-
bioRxiv - Physiology 2020Quote: ... mixed with one volume of 70% ethanol and applied directly to an RNeasy Mini Kit column (Qiagen). DNAse treatment on the column and total RNA recovery were performed as per the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: One µg of DNA was bisulfite-treated using the EpiTect® 96 Bisulfite Kit (Qiagen, Hilden, Germany) and analysed using the Infinium Human Methylation 450K BeadChips (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Viral genomic RNA (gRNA) was detected with a one-step real-time RT-PCR assay (Quantifast, Qiagen) using primers and probes generated to target either the SARS-CoV-2 E (28 ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-PCR was carried out using the QuantiTect probe RT-PCR kit (Qiagen, Valencia, CA) with 500 nM forward and reverse primers and 50 nM labeled probes (DENV2-FAM and ZIKV-FAM and PGK1-VIC TaqMan) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from one-week-old Arabidopsis seedlings using the RNeasy Plant Mini Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... One third of specimens were extracted using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA), while later extractions used a CTAB/PCI extraction approach (Chen et al. ...
-
bioRxiv - Genomics 2022Quote: ... bacterial pellets were pooled into one tube and DNA extracted with the Gentra Puregene tissue kit (Qiagen) with resuspension of the DNA pellet in 100 µl of nuclease-free water.
-
bioRxiv - Neuroscience 2021Quote: ... One microgram of RNA was reverse transcribed into complementary DNA using the QuantiTect Reverse Transcription Kit (Qiagen). The template amount of 6.6 ng RNA equivalent per wellt was used and the PCR reaction was performed in triplicate using the total volume of 8 µl in 384 well plate format ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA were extracted from approximately one million to two million cells using RNeasy Mini Kit (QIAGEN) according to the recommendation of manufacturer and then NEBNext® Poly (A ...
-
bioRxiv - Microbiology 2021Quote: ... RORC1 and RORC2 gene expression was evaluated by One step SYBR green real-rime RT-PCR (Qiagen) using a Light-Cycler 480 II as follows ...
-
bioRxiv - Genomics 2021Quote: ... One microgram of total RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcription Kit (QIAGEN, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... One section was added to a MACs M tube (Miltenyi Biotech, U.K.) containing 1ml Qiazol (Qiagen, U.K.) and dissociated on a GentleMACs (Miltenyi Biotech ...
-
bioRxiv - Immunology 2020Quote: PCR amplification of the RNA was completed using the One-step Syber Green RT-PCR Kit (Qiagen). 25ng of total RNA was added to a master mix reaction of the provided RT Mix ...
-
bioRxiv - Immunology 2020Quote: ... Extraction of these samples was performed using the BioSprint™96 One-For-All vet kit (Qiagen) and Kingfisher Flex platform as per manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... or 500 ng of total RNA for reverse transcription using the One Step RT PCR-Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: PCR amplification of the RNA was completed using the One-step Syber Green RT-PCR kit (Qiagen). 25ng of total RNA was added to a master mix reaction of the provided RT mix ...
-
bioRxiv - Neuroscience 2023Quote: ... VG and DRG were transferred into an 1.5ml tube containing one Tungsten Carbide bead (3mm, Qiagen, #69997) and 1 mL of Qiazol lysis reagent (Qiagen ...
-
bioRxiv - Biochemistry 2023Quote: RNA was isolated from one quarter of a mouse kidney using RNeasy Plus Mini Kit (Qiagen, 74134). For quantitative real-time PCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA was extracted from one haploid male at emergence using the MagAttract® HMW DNA Kit (Qiagen). The male wasp tissues were disrupted in a 2 mL tube containing 200 µL of 1X DPBS ...
-
bioRxiv - Zoology 2023Quote: Genomic DNA was extracted from one specimen using the Dneasy Blood & Tissue kit (Qiagen, Valencia, CA, USA), following the manufacturer’s instructions but with the initial proteinase K lysis step extended to 16 hours at 56°C with continuous agitation.
-
bioRxiv - Microbiology 2023Quote: ... with extraction performed as is the protocol for the BioSprint 96 One-For-All Vet Kit (Qiagen). Every eleventh of twelve wells in a 96-well plate was a blank DNA extraction control (seven in total ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was extracted from BC and NS using Biosprint 96 One-for-all vet Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: DNA was extracted from cell pellets using the BioSprint 96 One-For-All Vet processing kit (Qiagen) according to instructions with the following modifications ...
-
Microbial iCLIP2: Enhanced mapping of RNA-Protein interaction by promoting protein and RNA stabilitybioRxiv - Molecular Biology 2024Quote: ... one steel bead (5 mm diameter) was added and placed into a pre-cooled TissueLyser Adapter (Qiagen). The samples underwent two rounds of cell lysis ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was first extracted from one million cells using the RNeasy Mini Kit (cat. no. 74004, Qiagen) using an on-column DNase digestion (cat ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram of mRNA was reverse transcribed into cDNA by using an QuantiTect Reverse Transcription Kit (QIAGEN), according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA from h-iECs which have been expanded for 7 days was extracted using Rneasy Mini Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from ME49 Δhxgprt::Fluc tachyzoites and bradyzoites induced for 7 days at pH 8.2 using RNeasy Mini Kit (Qiagen) combined with QIAshredder (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... A neighbour-joining tree was built using the Jukes-Cantor nucleotide distance model and 1,000 bootstraps in CLC Sequence Viewer 7 (Qiagen).
-
bioRxiv - Microbiology 2020Quote: DNA for metagenomic sequencing was extracted from ~7 g sediment (~0.7 g sediment in 10 individual lysis tubes) using PowerSoil DNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the samples were run in the ViiA 7 Real-Time PCR System with the QuantiTect SYBR Green (Qiagen, 204143) (2017) ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA was harvested from post-transfection HuH-7 cells using the DNeasy Blood & Tissue Kit (Qiagen, catalog #69506). Similarly ...
-
bioRxiv - Immunology 2023Quote: M1 and M2 macrophages (300,000/well, 96-well plate) were transfected on Day 7 with MALAT1 or control GapmeRs (Qiagen). MALAT1- or control GapmeR-transfected M1 and M2 Mφ were incubated with Texas Red-conjugated Ova and DQ-conjugated Ova (both 1 mg/ml ...
-
bioRxiv - Immunology 2024Quote: ... GC B cells (Live/Dead-CD19+IgD-CD95+GL-7+) and naïve B cells (Live/Dead-CD19+IgD+) were flow sorted into RLT Plus buffer (Qiagen) following pre-enrichment with the Pan B Cell Isolation Kit II (Miltenyi) ...
-
bioRxiv - Immunology 2024Quote: RNA extraction from sorted CD8 T cell populations pooled from 5-7 mice (week 5 and 8 p.i.) was performed using the RNeasy Plus mini kit (Qiagen) following the manufacturer’s protocol ...