Labshake search
Citations for Qiagen :
651 - 700 of 2396 citations for 3 Cyclohex 1 enyl acrylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... The primer used in the 3’ RACE assay was designed using CLC Genomic Workbench (ver. 10.1.1, Qiagen) near the highest CAGE-Seq signal in the determined TSS region ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 mL were collected and used for plasmid extraction using a QI-Aprep Spin Miniprep kit (QIAGEN). Extracted plasmids were eluted in 30 μL of elution buffer and stored at −20 °C until use.
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Bioengineering 2022Quote: Total RNA content was extracted from 3 biological replicates using RNeasy® Plus Mini kit (#74134, Qiagen) following manufacture’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Extraction method 3 used a modified version of the Qiagen QIAamp Mini DNA kit (Qiagen, Venlo, Netherlands). Following initial pelleting ...
-
bioRxiv - Microbiology 2022Quote: ... 1ml of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized for 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Immunology 2021Quote: ... The samples (N=3) were collected immediately and soaked in 10 volumes of RNAlater (Qiagen, Hilden, Germany), for sequencing using Illumina (New England Biolabs) ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then washed 3 x with ice-cold 1x PBS and lysed in RLT buffer (Qiagen) with 1/100 β-mercaptoethanol (Sigma ...
-
bioRxiv - Genetics 2021Quote: Genomic DNA was extracted from an aliquot of 3 × 106 cells using the Gentra Purgene Kit (Qiagen). The genomic region surrounding the CRISPR/Cas9 target site (741 bp ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Bioengineering 2022Quote: ... messenger RNA (mRNA) combined from at least 3 gels were isolated with an RNeasy Mini Kit (Qiagen) and then reverse transcribed into complementary DNA (cDNA ...
-
bioRxiv - Immunology 2022Quote: ... DNA was extracted from frozen cell pellets (3×107 cells; Blood & Cell Culture DNA Maxi Kit, Qiagen) per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted (n=3) from the frozen endosperm tissue using the RNeasy PowerPlant kit (Qiagen). An on-column DNase digest was incorporated during the extraction ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA (>200nt) was extracted from 400 testes of ≤3 days old flies using miRNeasy Mini column (QIAGEN). For the first replicate ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from 3-4 two-week old gemmae using the RNeasy Plant kit (#74903, Qiagen) with RLT buffer supplemented with beta-mercaptoethanol ...
-
bioRxiv - Microbiology 2024Quote: ... MRU2687-3 and ZH548 viral stocks were extracted using the QIAmp Viral RNA kit (Qiagen; Courtaboeuf, France) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Cancer Biology 2023Quote: Small interfering RNA was obtained to knockdown the expression of ARSB and galectin-3 (Qiagen, Germantown, MD). Effects on mRNA were determined by QRT-PCR ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from patient material (n=3) and organoids (xxx) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant from the second spin was incubated with 3 mL of Ni-NTA agarose beads (Qiagen) for 30 minutes at 4°C in the cold room ...
-
bioRxiv - Cell Biology 2024Quote: ... Tissues were homogenized for five 3-minute cycles of 30 shakes/sec using a TissueLyser II (Qiagen) and transferred to an RNase free microfuge tube (Ambion ...
-
bioRxiv - Bioengineering 2024Quote: ... Tsg101 (Hs_TSG101_6) target sequence: 5′-CAG TTT ATC ATT CAA GTG TAA -3′ (QIAGEN, cat. no. SI02655184); Alix (Hs_PDCD6IP_5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Alix (Hs_PDCD6IP_5) target sequence: 5′-AAG AGC TGT GTG TTG TTC AAT -3′ (QIAGEN, cat. no. SI02655345); Negative Control siRNA ...
-
bioRxiv - Immunology 2024Quote: ... we transfected the 293T cells at 3 million cells/10 cm dish with Effectene transfection reagent (Qiagen) following manufacturer guidelines ...
-
bioRxiv - Cancer Biology 2024Quote: The FASTQ file was analyzed by QIAseq UPX 3’ Transcriptome Primary Quantification tool (QIAGEN GeneGlobe analysis website) to generate gene expression matrix ...
-
bioRxiv - Cell Biology 2024Quote: ... RNase-A was degraded by the addition of proteinase-K (3 mAU/mL, 19131, Qiagen, Hilden, Germany) and inverting the tube briefly ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated from 3 months old Pgrcre and FOXL2OE diestrus uteri using RNeasy mini kit (Qiagen). The library was prepared using TruSeq RNA Library Prep kit (Illumina ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-day-old seedlings using a QIAshredder and RNeasy Plus Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1000 µL PBS was added to each sample (lungs, 0.01–0.04 g) along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized at a speed of 10 Hz for 10 min and then centrifuged at 15,000 × g for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were then ground to powder using a 3 mm tungsten carbide bead (Qiagen Cat. No. / ID: 69997) on a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... homogenized in sterile 0.05 % NP40 in H2O for 3 minutes at 25 Hz using a Tissue Lyzer (Qiagen) and serial dilutions were plated on YPD agar containing 100 μg/ml Ampicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were transfected at 3 DIV with siRNA targeting Kdm6a or ntRNA using Effectene Transfection Reagent (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 500 µl of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized during 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then washed 3 times with PBS and lifted with 500µL/well of Cell Protect Reagent (Qiagen) for 5 min ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... benthamiana leaves were grinded in a tube with two glass beads (3 mm) with a TissueLyser II (Qiagen) and directly after supplied with 600 μl EB ...
-
bioRxiv - Genetics 2020Quote: ... 4 dpe on-tet n=3) was extracted using the Qiagen RNeasy Mini Plus Kit (Qiagen, Hilden, Germany), which includes a column-based genomic DNA removal step ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from an aliquot of 3 x 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was isolated from HEK293T cells 3 days after transfections using the Gentra Puregene Cell Kit (Qiagen) and was diluted to 10 ng/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...