Labshake search
Citations for Qiagen :
6701 - 6750 of 10000+ citations for C Reactive Protein ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... PCR amplification was performed on Gentra PureGene Tissue Kit (Qiagen) extracted genomic DNA ...
-
bioRxiv - Bioengineering 2021Quote: ... dsDNA was extracted using the Plasmid Miniprep Kit (Qiagen, 27104). dsDNA concentration was measured using a Nanodrop (Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Total RNA was extracted using the RNeasy Mini Kit (Qiagen), quantified using the NanoDrop 2000 (Thermo Scientific™) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... leucarpum using the DNeasy anr RNeasy Plant Mini Kit (QIAGEN) respectively ...
-
bioRxiv - Bioengineering 2020Quote: ... and purified with the RNeasy Plus mini kit (Qiagen, Germany) following the manufacturers’ protocols ...
-
bioRxiv - Bioengineering 2020Quote: ... mRNA was isolated using the RNeasy Mini kit (Qiagen, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... and reverse transcription was performed with Omniscript RT Kit (Qiagen). The PCR amplifications were conducted using Taq DNA Polymerase with Standard Taq buffer (New England Biolabs) ...
-
bioRxiv - Bioengineering 2020Quote: ... then RNA was isolated using the RNeasy Mini Kit (Qiagen) with on-column DNase I (Qiagen ...
-
bioRxiv - Bioengineering 2020Quote: ... using a QIAprep Spin Miniprep kit (QIAGEN, Valencia, CA, USA)96 ...
-
bioRxiv - Bioengineering 2020Quote: ... Plasmids were purified using the QIAprep spin miniprep kit (Qiagen).
-
bioRxiv - Genomics 2020Quote: RNA extraction was performed using an RNeasy Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... and ran through a RNeasy Mini Kit purification column (QIAGEN). Samples were treated with DNase I (QIAGEN ...
-
bioRxiv - Biochemistry 2020Quote: ... DNA fragments were isolated using a DNA purification kit (Qiagen). The immunoprecipitated DNA and 10% of the pre-cleared chromatin (input DNA ...
-
bioRxiv - Biochemistry 2020Quote: ... Plasmid DNAs were initially isolated using a maxiprep kit (Qiagen). To remove nicked plasmid species ...
-
bioRxiv - Biochemistry 2020Quote: ... and was purified using a QIAquick PCR purification kit (Qiagen). The ChIPed DNA was assessed qPCR as described above ...
-
bioRxiv - Immunology 2020Quote: ... RNA was isolated using RNeasy Mini or Micro kits (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was extracted using the RNeasy Plus Micro Kit (Qiagen), together with a genomic DNA eliminator column and a 30-minute incubation with DNAse I (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted using the RNeasy Mini kit (Qiagen) and subjected to sequencing using the HiSeq 2500 platform (Illumina) ...
-
bioRxiv - Neuroscience 2021Quote: RNA extraction was performed using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instruc tions ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was generated with the Quantitect Reverse transcription kit (Qiagen). Using the 2-ΔΔCt method ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted using QIAsymphony RNA kit (#931636, Qiagen). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... total small RNAs were isolated using miRneasy Mini kit (Qiagen) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was isolated using the RNeasy Mini Kit (QIAGEN) and reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2020Quote: ... neurite RNA was isolated using RNAeasy Microisolation Kit (Qiagen, CA).
-
bioRxiv - Neuroscience 2020Quote: ... the overlap extension product was purified (QIAGEN, PCR purification kit). The mScarlet-I sequence (based on Addgene Plasmid #85068 ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by clean-up with the RNeasy Mini Kit (Qiagen). Total RNA yield and quality was determined using a NanoDrop ND-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... The RNA was purified using miRNeasy® Mini Kit (Qiagen), and all samples had RIN values >7.5 ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated by using the RNeasy Kit (Qiagen), and cDNA synthesis was performed using SuperScript II Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA produced with the Omniscript RT Kit (Qiagen, #205111) with oligo dT primers ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated with the RNeasy Mini Kit (Qiagen, #74104) and cDNA produced with the Omniscript RT Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated using the RNeasy Mini Kit (Qiagen) from Trp53 KO or Trp53 mutant astrocytes ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA was isolated using the RNeasy Mini Kit (Qiagen). RNA quality was assessed using BioAnalyzer 2100 and/or TapeStation RNA Screen Tape (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... and the RNeasy Plus RNA Extraction Kit (Cat# 74134, Qiagen). cDNA was generated using the TaqMan Reverse Transcriptase Kit according to the manufacturer’s instructions (Cat# N8080234 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was extracted using RNeasy Mini kit (Qiagen, cat# 74104), followed by quality assessment via Agilent 2200 Tape Station ...
-
bioRxiv - Biophysics 2020Quote: ... and DNA was extracted using the Blood Mini Kit (Qiagen). Early (RU5 ...
-
bioRxiv - Genomics 2019Quote: ... DNA was extracted using the QIAamp DNA Micro Kit (Qiagen). The extraction followed the protocol of the manufacturer ...
-
bioRxiv - Cancer Biology 2020Quote: ... samples were subjected to Allprep DNA/RNA Mini Kit (QIAGEN) following the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were purified using QIAquick PCR Purification kit (Qiagen). PCR products were followed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... and root tissues using a Qiaprep Spin Miniprep kit (Qiagen). At 14 d (16 days post-inoculation ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen), followed by PCR using the primers ACACGCTTGGGAATGGACAC and CCATGGGAAGATGTTCTGGG and separation on 4% agarose ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated using the RNAeasy Mini Kit (Qiagen), and cDNA was synthesised using SuperScript III (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and DNase treated with the RNase-Free DNase kit (Qiagen) following manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RNA was extracted using RNeasy Micro Kit (Qiagen #74004). RNA concentration was assessed with a Nanodrop spectrophotometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was extracted with the RNeasy mini kit (Qiagen). PolyA-tailed mRNA was selected with beads from 1μg total RNA using the NEBNext Poly(A ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted with the RNeasy Plus kit (QIAGEN) and reverse transcribed using iScriptΪ™ Select cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was isolated using the miRNeasy mini kit (217004, Qiagen [WERFEN ESPAÑA ...
-
bioRxiv - Cancer Biology 2020Quote: ... using miScriptSYBR Green PCR kit (Perfect Real Time) (Qiagen, #218161). Reaction mixtures were incubated for 10 min at 95 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted using the RNeasy Mini kit (QIAGEN) following the protocol for “Purification of Total RNA from Plant Cells and Tissues and Filamentous Fungi” including an on-column DNAse digest ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted from cells with an RNeasy Kit (Qiagen) and was sequenced using Illumina TruSeq strand specific library ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted from cells using the RNeasy kit (Qiagen), and subsequently converted into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermofisher) ...