Labshake search
Citations for Qiagen :
601 - 650 of 10000+ citations for Recombinant Human KIT His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... individual Human SHANK3 siRNA_2 (Cat. no. S100717710 Hs_SHANK3_2 siRNA, Qiagen) and individual ON-TARGETplus Human SHANK3 siRNA_7 (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, Catalog Number ...
-
bioRxiv - Molecular Biology 2023Quote: A siRNA library targeting all human kinases (Qiagen, Hilden, Germany) was utilized ...
-
bioRxiv - Biochemistry 2020Quote: ... and the recombinant protein was purified by gravity-flow chromatography using a nickel-charged resin Ni-NTA Agarose (QIAgen) equilibrated with 10 mM imidazole in the lysis buffer ...
-
bioRxiv - Microbiology 2021Quote: The pulldown protocol was based on the principle of immobilization of recombinant protein using Ni-NTA agarose resin (Qiagen). The experiments were performed in biological triplicates and designed to contain 4 control samples (resin Ni-NTA with i ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol and 1 mM DTT) and recombinant TrcP was purified from clarified lysates using Ni-NTA resin (Qiagen) and gravity chromatography ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant protein was purified by affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant proteins were purified to near homogeneity (>95%) using Ni-chelate affinity chromatography on Ni-NTA Superflow resin (Qiagen) using standard protocols ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were then stained by Coomassie-blue or immunodetected as described before [26] using primary polyclonal antibodies directed against His6 epitope-tag (Penta His, Qiagen, dilution 1:1000), V5 epitope-tag (Bethyl Laboratories ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were incubated at 95°C for 5 minutes and spun down at 17K x g for 10 min to remove cell debris before analysis of raw supernatant was performed via SDS-PAGE using a 12% acrylamide-tris gel and subsequent overnight transfer to a Western blot PVDF membrane and visualization with an anti-His antibody (Qiagen Cat# 34440, RRID:AB_2714179).
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Cell Biology 2021Quote: ... The lysate was cleared via centrifugation and recombinant PfCen3-6xHis were purified from the soluble fraction using Ni-NTA agarose beads (QiaGen) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... 6XHis tagged-Trx1 and Trr1 recombinant proteins were cloned in PET24 vectors and purified by column affinity onto Ni-NTA beads (Qiagen). The precursor was imported in 50 μg of the indicated yeast mitochondria in the presence of 2 mM ATP and 2.5 mM NADH at 30°C ...
-
bioRxiv - Microbiology 2020Quote: ... cells were either left untreated or treated with 1000 IU/ml recombinant IFN-α treatment and incubated for 6 h or transfected overnight with polyI:C (10 μg/ml) using Polyfect (Qiagen). Luciferase assays were carried out ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding the recombinant RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). On Day 0 ...
-
bioRxiv - Biophysics 2023Quote: ... coli strain M15-[pREP4] (for transformation of recombinant plasmids) and RNAse (for protein purification) were purchased from Qiagen (Valencia, CA). All other chemicals were obtained from Sigma-Aldrich (St ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant protein was partially purified by affinity chromatography on nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com). Purification steps were carried out as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Cancer Stem Cells RT² Profiler PCR Array from Qiagen was used to profile the expression of 84 genes linked to cancer stem cells (CSCs ...
-
bioRxiv - Cancer Biology 2022Quote: Human EMT qPCR arrays were purchased from Qiagen (Cat. #: PAHS-021Z), performed as described using RNA from PDX mammary tumors grown in SOFT and STIFF Col1/rBM hydrogels ...
-
bioRxiv - Biophysics 2020Quote: ... Bacterial extracts were prepared as described46 and the recombinant protein was purified using an Ni-NTA Superflow cartridge (Qiagen, Hilden, Germany) and eluted with imidazol47 ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid was transfected to 293T cells and the recombinant S protein trimers were purified by Ni-NTA (nickel-nitrilotriacetic acid) chromatography (QIAGEN, Germany), followed by size exclusion to further purify the trimers ...
-
bioRxiv - Cell Biology 2022Quote: FASTQ files generated by sequencing human macrophages were imported into ArrayStudio (Qiagen). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were applied to the Human Aging RT2 Profiler PCR arrays (Qiagen) and run on Bio-Rad CFX384 real time thermocycler ...
-
bioRxiv - Immunology 2023Quote: Human skin tissues were homogenized with RLT buffer (Qiagen, Hilden, Germany, 79216) supplemented with 1% β-mercaptoethanol (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers for human ZMPSTE24 Hs_ZMPSTE24_1_SG QuantiTect) were predesigned and validated by QIAGEN and used diluted to a final work solution of 1x (QuantiTect Primers ...
-
bioRxiv - Developmental Biology 2023Quote: FlexiTube siRNA was used to knock-down human PDE2A (Cat#: SI00040159, Qiagen). AllStars Negative CTRL siRNA was used as control (Cat# ...
-
bioRxiv - Cell Biology 2024Quote: ... serially diluted matching human PCR amplicons cloned into the pDrive vector (Qiagen) were used to generate a standard curve ...
-
bioRxiv - Genetics 2021Quote: ... The final constructs were transformed into BL21 (DE3) for expression and recombinant Fur/mFur proteins were purified using Ni-NTA agarose (Qiagen, California, USA). The proteins induced by the addition of 1 mM IPTG at 16°C for 12 h ...
-
bioRxiv - Neuroscience 2021Quote: Cytokine secretion assays were performed using Human Multi-Analyte ELISArray plate (Qiagen CMEH6321A). IL1β ...
-
bioRxiv - Pathology 2019Quote: Total RNA of human podocytes was extracted per manufacturer’s instructions (Qiagen, Germantown, MD) and 1 μg RNA was used for cDNA synthesis (Transcriptor first strand cDNA synthesis kit ...
-
bioRxiv - Genomics 2019Quote: We analyzed human and mouse Tug1 cDNA sequences with CLC Genomics Workbench (Qiagen) for open reading frames (ORFs) ...
-
bioRxiv - Neuroscience 2022Quote: ... using commercially available primers for human FAAH (CpG Island 100530) (EPHS100530-1A, Qiagen). Methylation-sensitive (EPHS115450-1A ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Genomics 2022Quote: ... pallidum and human RNase P gene (RNP) using a Rotor-Gene 6000 instrument (Qiagen) as previously described with modifications (11 ...
-
bioRxiv - Neuroscience 2022Quote: Cultured human T cells after treatment were flash frozen in Buffer RLT (Qiagen, 79216) and kept in −80°C until processing ...
-
bioRxiv - Genomics 2019Quote: Dissociated human islets cells were transfected with scramble siRNA (Cat# 1027284, Qiagen, Toronto, Canada) or siRNA from ThermoFisher Scientific against OGDHL (ID# s31422) ...
-
bioRxiv - Genomics 2021Quote: cDNA was generated from 5μg of Human XpressRef Universal Total RNA (Qiagen cat # 338112) using Superscript III Reverse Transcriptase (Invitrogen cat # 18080093 ...
-
bioRxiv - Microbiology 2021Quote: The RTK RNAi library contained siRNAs targeting 56 human RTK genes (Qiagen, Dusseldorf, Germany), which included four different pairs of siRNAs for each gene ...
-
bioRxiv - Neuroscience 2023Quote: Transfected iPSC-OPCs and post-mortem human MS samples were lysed in Qiazol (Qiagen), and RNA was isolated using a standard chloroform extraction and ethanol precipitation method ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: Bacterial and human cells were treated with RNAprotect cell or bacterial reagent (Qiagen, Germany) and stored at -80°C for up to 1 week ...
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...