Labshake search
Citations for Qiagen :
601 - 650 of 1091 citations for Anti Cullin 5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... A 5 ml aliquot of culture was removed and added to 10 ml of RNAprotect Bacteria Reagent (Qiagen) and mixed by vortexing ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Physiology 2023Quote: ... a 5 mg piece of kidney tissue was homogenized in 350 μL of RNeasy RLT Lysis buffer (Qiagen) containing 2-mercaptoethanol and centrifuged at maximum speed for 3 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Edmund Bühler) by bead beating twice for 5 min at 30 Hz in a Tissue Lyzer II (QIAGEN). Lysates were then incubated for 30 min at 37 °C with shaking ...
-
bioRxiv - Biochemistry 2023Quote: ... Sequences with an E-value lower than 1e-5 were used for multiple sequence alignment using CLC v 21.0.5 sequence manager (Qiagen). After multiple rounds of alignments and manual removing non-nAChR sequences a set of 2047 proteins were obtained ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Biochemistry 2023Quote: ... High speed supernatant (HSS) was then batch bound to 5 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) resin at 4ºC for 2 hours stirring in a beaker ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plates were then placed at 4 0C before adding the reverse transcription mix containing 5’-biotinylated TSO (Qiagen). PCR products were cleaned up using 0.8:1 Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were eluted using an imidazole gradient and subsequently loaded onto a 5 ml StrepTactin Superflow Cartridge (Qiagen) at a flow rate of 0.8 ml/min ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Immunology 2023Quote: RNA was purified from at least 5 x 104 CD4+ T cells using the RNeasy Micro kit (Qiagen). cDNA was synthesized using the SuperScriptTMVILOTMcDNA synthesis kit (Invitrogen) ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... Single blastocysts were collected from the M2 drop in 5 µL of 1x TCL lysis buffer (Qiagen #1031586) containing 1% (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... Each of the wells that the nuclei were sorted into contained 5 uL of EB buffer (Qiagen, 19086), 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... 200 ng psiCHECK-2 reporter plasmid were co-transfected with 5 µl miScript miRNA mimics (Qiagen; CatNo. 219600) using 4 µl Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-His tag (1:2000; QIAGEN) and rabbit anti-GST (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-His from Qiagen (1:10,000), home-made rabbit anti-VASH1 ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-RGS-His (Qiagen, 1:2000, 34610), anti-Myc (ChromoTek ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... we used anti RGS HIS6 HRP(QIAGEN) Cat.n°/ID 34450.
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-has-miR-130b-3p (Qiagen, MIMAT0000691) and Ant-has-miR-130b-5p (Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... and anti-His mAb (QIAGEN, Hilden, Germany) was added (1 µg/mL in PBS supplemented with 1% w/v BSA) ...
-
bioRxiv - Biochemistry 2021Quote: ... Electroblotted membranes were incubated with penta-His antibody (Qiagen, Valencia, CA, USA). The antigen–antibody complex was visualized with alkaline phosphatase-linked to anti-rabbit IgG followed by staining with 5-bromo-4-chloroindol-2-yl phosphate and nitro blue tetrazolium [36].
-
bioRxiv - Microbiology 2021Quote: ... The followed antibodies and dilutions were used: Strep 1:1000 (Qiagen, 34850), PAF1 1:1000 (Bethyl Labs #A300-173A) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Biophysics 2020Quote: ... the surface was incubated with 1 nM biotinylated penta-His antibody (Qiagen) in buffer A for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tag ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse penta-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Microbiology 2022Quote: ... and immunoblotted using a mouse monoclonal antibody against Strep-tag (Qiagen, 34850). Alkaline phosphatase conjugated to anti-mouse IgG (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Mouse antibody genes were amplified using HotstarTaq DNA polymerase (Qiagen Cat # 203209) with the primer sets specific for the IghIOMAiGL and IgkIOMAiGL transgenes ...
-
bioRxiv - Biochemistry 2023Quote: ... a conjugate of mouse monoclonal penta-His antibody and horseradish peroxidase (Qiagen) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... brefeldin A (2.5 μg/mL) and MG132 (2.5 μM) for 24 hr prior to RNA isolation with RNAeasy Mini Kit (Qiagen). One μg of purified RNA was reverse transcribed into cDNA using the Protoscript II Reverse Transcriptase kit (New England Biolabs) ...
-
bioRxiv - Genetics 2021Quote: ... The 10 μL reaction was carried out with 40 ng genomic DNA and 0.2 μM of each primer and 5 mM Multiplex PCR Kit (Qiagen). Cycling conditions were identical for both directions with 95°C 15:30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... A 5 mm stainless steel bead was subsequently used to homogenize the tissue using the TissueLyser II system (Qiagen) for 2x 5 min at 20 hz ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was stopped by adding 2.5 uL of 0.5M EDTA pH 8 and transposed DNA was purified using Qiagen MiniElute PCR purification kit (Qiagen). Purified DNA was amplified using the following condition ...
-
bioRxiv - Immunology 2022Quote: For RT product measurements DNA was extracted from 5×105 infected cells using the DNeasy Blood & Tissue kit (QIAgen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... then PCR-amplified using the PyroMark PCR kit using Qiagen’s pyrosequencing primer assays or those designed in-house (Suppl. Table 5) via the PyroMark Assay Design Software 2.0 (Qiagen). Reaction conditions were as follows ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... n=4 females [hybrid cross] and n=5 females [conspecific cross]) using the AllPrep RNA/DNA Mini Kit (Qiagen), and was stored at −80°C until sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... was performed by using 2.5 μL of the synthesized and diluted cDNA in the presence of 5 μL QuantiTect SYBR Green (204143, Qiagen) and 1 mM specific primers (S6 Table ...
-
bioRxiv - Cell Biology 2021Quote: RNA from 5-10 million NK cells treated overnight with indicated conditions was extracted using Rneasy Plus kit (Qiagen). Samples were prepared for Illumina sequencing following the manufacturer’s protocol using the TruSeq® stranded total RNA with rRNA depletion using Ribo Zero TM Human/Mouse/Rat ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the biofilms were disrupted by pipetting thoroughly and homogenized with a stainless bead beater 5 mm in diameter (Qiagen) for 10 min at a frequency of 30 beats per second by TissueLyser II (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... 100 μl of total RNAs were extracted from 5 × 105 replicon cells using RNeasy mini kit (Qiagen, Gaithersburg, MD). 2□μl of each sample was used to assess RNA quality using Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Physiology 2021Quote: ... PBS) using a 5 mm stainless steel bead at 30 hertz for 45 seconds in a TissueLyser II (Qiagen). Samples were then centrifuged at 10,000 g for 10 minutes at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... For RT product measurements DNA was extracted from 5×105 infected cells using the DNeasy Blood & Tissue kit (QIAgen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA were extracted from roots 5 days after germination using the RNeasy® Plant Mini kit (Qiagen #74904) according to the manufacturer’s instructions ...