Labshake search
Citations for Qiagen :
601 - 650 of 1920 citations for 4 Chloro 2 fluoro 3' 4 methylpiperazinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Neuroscience 2024Quote: ... using a 3 mm bead (Qiagen 69997) and agitation with the Tissue Lyser II (Qiagen ...
-
bioRxiv - Cell Biology 2024Quote: ... dynamin 2 (Qiagen), CDC42 (Dharmacon) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA of the 20 Jan and 3 Mar 2021 samples (1/3 pellet) was extracted with the DNeasy UltraClean Microbial Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Total RNA from epididymis white adipose tissue of wide type control mice (n=3) and miR-802 KI mice (n=3) was isolated using the RNeasy mini kit (Qiagen) following the protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was obtained and amplified in a first-round PCR (RdRpS1 5’-GGKTGGGAYTAYCCKAARTG-3’, RdRpR1 5’-TGYTGTSWRCARAAYTCRTG-3’) using One-Step RT-PCR Enzyme MixKit (Qiagen) with the total expected size of 602 base pairs (bp) ...
-
bioRxiv - Genomics 2024Quote: ... RNA was first amplified using a first-round PCR (RdRp S1 5ߣ-GGKTGGGAYTAYCCKAARTG -3’, RdRp R1 5’-TGYTGTSWRCARAAYTCRTG-3’) with the One-Step RT-PCR Enzyme MixKit (Qiagen), targeting a total expected size of 620 base pairs (bp) ...
-
bioRxiv - Cell Biology 2024Quote: ... target sequence 5’-TTGCTTGGAGGCTACTCCCAA-3’) and control non-silencing scrambled siRNA (siSCR, target sequence 5’-AATTCTCCGAACGTGTCACGT-3’) were obtained from Qiagen. MAPK15-specific siRNA #2 (siMAPK15 #2 ...
-
bioRxiv - Genetics 2024Quote: ... Total RNA isolation from Tbx4-CKO (n = 3) and Tbx4fl/fl (n = 3) lungs was performed using the RNeasy Mini Kit (Qiagen). The changes in gene expression were investigated by quantitative reverse transcription polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Plant Biology 2020Quote: Reduced His-tagged PRX-IIE (3 mg) or PRX-IIE C146S (3 mg) were bound to 1 mL Ni-NTA resin (Qiagen, Hilden, Germany) and used as affinity matrix ...
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated from the VTM in a biosafety level-3 (BSL-3) laboratory using QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...
-
bioRxiv - Neuroscience 2022Quote: ... and 18S rRNA (5’-GAG CGA AAG CAT TTG CCA AG-3’ and 5’-GGC ATC GTT TAT GGT CGG AA-3’) on a Roter-Gene Q (Qiagen, Hilden, Germany) with 2x AmpiGene® qPCR Green Mix Lo-ROX (Enzo Biochem ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Plant Biology 2022Quote: ... using 3-mm steel beads (Cat No.: 69997, Qiagen); tubes were shaken for 20-s at 28 Hz with dry ice.
-
bioRxiv - Evolutionary Biology 2022Quote: ... with two sterile 3 mm beads (Qiagen, Hilden, Germany) and a bead device at 20 Hz for 3 min ...
-
bioRxiv - Immunology 2020Quote: ... and prepared the QIAseq UPX 3’ Transcriptome Kit (QIAGEN). 10ng purified RNA was used for the NGS libraries ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in 3 volumes RLT buffer (Qiagen) and RNA was extracted using Dynabeads MyOne Silane (Life technologies) ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Biochemistry 2021Quote: ... using a TissueLyser II (3 min, 30 Hz; Qiagen). After vigorous mixing with chloroform at a 1:4 v/v ratio (chloroform:TRIzol) ...
-
bioRxiv - Genomics 2021Quote: ... 3 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template containing cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3 min in TissueLyser II (30 Hz; Qiagen). Cell lysates were centrifuged for 15 min (4 °C ...