Labshake search
Citations for Qiagen :
601 - 650 of 3700 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4C (Qiagen, SI05163977), and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Developmental Biology 2020Quote: ... rhesus fibroblast cell line (n=1), pri-CTB (n=1, rh090419) and TSCs (n=3 rh121118, rh052318, cy091318) using a FlexiGene DNA Kit (Qiagen, cat no: 51206) and quantified using a Nanodrop™ One Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Resuspend the cells in 10 ml of suspension buffer (10 mM EDTA pH8.0, 150 mM NaCl, 1% glycerol, Lysis blue (1×, from QIAGEN Plasmid Plus Midi Kit), RNase A (0.55 mg/ml) ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Biophysics 2020Quote: ... The studies were carried out on a Rotor-Gene Q 6 plex (QIAGEN) instrument at a heating rate of 2 °C/min and a temperature range of 25-90 °C ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 6 dpf larvae (RNeasy Plus Mini Kit; Qiagen) and reversed transcribed (iScript Reverse Transcription Supermix ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RPR2 (n=6) primary tumors was performed using RNeasy Mini Kit (Qiagen) with the standard protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The 6 PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) to eliminate byproducts.
-
bioRxiv - Genetics 2023Quote: RNA was extracted from 6-well plates using miRNeasy Mini Kits (QIAGEN 217004) with the inclusion of an on-column DNase digestion (QIAGEN 79254) ...
-
bioRxiv - Biochemistry 2024Quote: ... The 6×His-tag-FACT complex was captured with Ni-NTA beads (Qiagen) while rotating at 4 ℃ for 1 hour ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Genetics 2024Quote: ... 4 µL RNase (QIAGEN, Venlo, The Netherlands) was added ...
-
bioRxiv - Immunology 2024Quote: ... containing 4 IU/ul DNAseI (Qiagen, 79254) and 1 IU/ul RNAseq inhibitor (Recombinant RNAsin ...
-
bioRxiv - Cell Biology 2024Quote: ... with 4 µg/mL DNase (79254, Qiagen) at 37 °C for 15-20 min ...
-
bioRxiv - Microbiology 2020Quote: ... into 1 ml of RNA Protect solution (Qiagen, Hilden, Germany)
-
bioRxiv - Biochemistry 2022Quote: ... and incubated with 1 ml of Ni-Sepharose beads (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Systems Biology 2020Quote: ... cells were resuspended in 1 ml buffer RLT from Qiagen RNeasy kit ...
-
bioRxiv - Bioengineering 2021Quote: ... Supernatants were digested in 1 mg/ml Proteinase K (Qiagen) for 12 h at 55 °C then boiled for 10 min to inactivate the enzyme ...
-
bioRxiv - Cell Biology 2021Quote: ... Validated qPCR primers and primer assays (Qiagen, see Table 1) were used together with QuantiTect SYBR Green PCR kit (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: ... approximately 100 mg was stored in 1 ml RNAlater (Qiagen) for at least 4 days for stabilization ...
-
bioRxiv - Microbiology 2021Quote: ... was packed with 1 mL of Ni-NTA superflow (Qiagen). After washing with 10 mL of MilliQ water ...
-
bioRxiv - Immunology 2022Quote: ... and incubated with Penta-His-biotin conjugate 1:5000 (Qiagen) overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were resuspended in 1 mL RLT Buffer (Qiagen 79216) and vortexed for 1 minute ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl of diluted (0.08x) FastSelect rRNA HMR (Qiagen, Germany) and 1 μl of diluted (0.08x ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl of diluted (0.08x) FastSelect rRNA HMR (Qiagen, Germany) was added into 6 μl COVID-19 specimen RNA along with 3 μl NA denaturation buffer ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µg/ µl BSA and 10X HotStartTaq Master Mix (Qiagen). Cycling conditions included initial denaturation at 95°C for 15 min ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and 1 mL of QIAzol lysis reagent (Qiagen, item #79306). Tissue homogenization was done by agitating the tubes for 20□s at a 7□m□s−□1 speed (Beadbug 6 homogenizer ...
-
bioRxiv - Microbiology 2021Quote: ... Tris 10 mM) supplemented with 1% Proteinase K (Qiagen #19133) and 1% RNAse A/T1 (ThermoFisher #EN0551 ...
-
bioRxiv - Biochemistry 2022Quote: ... was passed through a 1 mL NiNTA-agarose column (Qiagen) preequilibrated with the TRIS/urea buffer ...
-
bioRxiv - Microbiology 2023Quote: ... with the oligonucleotides for THP-1 cells (obtained from Qiagen) and P ...
-
bioRxiv - Biophysics 2024Quote: ... or subjected to immunoblotting with either Penta·His (1:1,000; QIAGEN) or Anti-c-Myc (1:5,000 ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was extracted from 1✕106 PBLs (Qiagen, 75144) and a reverse transcription reaction was performed to produce the DNA copy (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... et al.[1] was performed as described using HotStarTaq (Qiagen). A Poc 18S rRNA plasmid (MRA-180 ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 μL of 10 mg/mL RNase A (Qiagen), then incubating at 37°C for 1.5 hr without shaking ...
-
bioRxiv - Microbiology 2022Quote: ... Thawed cells were suspended in 1 ml RLT buffer (Qiagen) containing 2-mercaptoethanol and lysed by bead beating ...
-
bioRxiv - Cell Biology 2023Quote: ... TAZ or KIF3A from Qiagen (listed in Supplementary Table 1). After transfection ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl carrier RNA (1µg, from Qiagen, cat. no. 59824), 4 µl of Dr.GenTLE precipitation carrier (Takara ...
-
bioRxiv - Genetics 2023Quote: ... and 1 uL of FastSelect rRNA-depletion enzyme (Qiagen #335377). To complete the fragmentation and deletion process ...
-
bioRxiv - Biochemistry 2023Quote: ... and a 1 mL slurry of Ni-NTA beads (Qiagen) pre-equilibrated with lysis buffer was added ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared extract was loaded onto 1 ml NiNTA resin (Qiagen) preequilibrated with Nickel buffer (25 mM HEPES-NaOH pH 7.4 ...