Labshake search
Citations for Qiagen :
551 - 600 of 6287 citations for SARS CoV 2 Spike Glycoprotein S1 His tag Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: HeLa cells (2×106) were transfected with 100 pmol of validated siRNAs against all human ZDHHCs [42] (Qiagen) using interferrin transfection reagent (Polyplus) ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Genomics 2021Quote: Total RNA was collected from 2×106 CAR T cells with the RNEasy Plus Mini isolation kit (Qiagen). Library preparation and RNA-seq was performed by BGI America (Cambridge ...
-
bioRxiv - Biochemistry 2021Quote: ... brucei genomic DNA was isolated from ∼ 2 × 108 bloodstream form cells using a DNeasy Blood & Tissue Kit (Qiagen) using standard methods.
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Systems Biology 2022Quote: ... Aliquots of 2 mL of cell cultures were submitted to DNA extraction using DNeasy Blood & Tissue kit (QIAGEN). DNA samples were quality checked and genotyped using PCR to confirm strains (Table S5) ...
-
bioRxiv - Microbiology 2023Quote: ... 150 μL of the aggregated or non-aggregated cells were then washed with 2 volumes of RNAprotect (Qiagen) to prevent RNA degradation ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA from approximately 2 million SNU16 cells was extracted using the MagAttract HMW DNA Kit (Qiagen 67563) and prepared for long-read sequencing using a Ligation Sequencing Kit V14 (Oxford Nanopore Technologies SQK-LSK114 ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Biochemistry 2023Quote: ... brucei genomic DNA was isolated from ∼2 × 108 bloodstream form cells using a DNeasy Blood & Tissue Kit (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: ... brucei genomic DNA was isolated from ∼ 2 × 107 bloodstream form cells using a DNeasy Blood & Tissue Kit (Qiagen) using standard methods.
-
bioRxiv - Immunology 2024Quote: ... 2 × 104 cells were sorted in triplicate per sample and stored at −80°C in RLT buffer (Qiagen). RNA was isolated using the Qiagen RNeasy Micro Kit ...
-
bioRxiv - Neuroscience 2024Quote: RNA was extracted from SH-SY5Y and SK-N-BE(2) cells using the RNeasy mini kit (Qiagen) following the manufacturer’s protocol including the on-column DNA digestion step ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged PSK1 or RGF1 precursors were purified from bacterial extracts by metal chelate affinity chromatography on NiNTA Agarose (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: The recombinant His-TvFACPα full-length protein was produced and purified by a standard protocol as suggested by the supplier (QIAGEN, Hilden, Germany) (48 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and unfragmented genomic DNA (A260/A280 ≥ 1.8 and A260/A230 ≥ 1.9) was extracted from whole blood obtained from the subject and his parents using the Puregene Blood kit from Qiagen (Valencia, CA). Whole exome sequencing was performed using the service provided by Beijing Genomics Institute (Cambridge ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis of 100 ng total RNA was performed with miRCURY LNA RT Kit (10 µl volume reaction) which adds a 5’ universal tag of a poly(A) tail to mature miRNA templates (QIAGEN, Germantown, MD). cDNA template was diluted 1:10 ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Microbiology 2019Quote: ... RNA was extracted from 1 ml cell suspensions of each isolate standardised to A600 0.65 (containing approximately 2 x 108 cells) using the RNeasy Mini kit (Qiagen) with enzymatic lysis and Proteinase K digestion ...
-
bioRxiv - Neuroscience 2020Quote: ... each individual cell was transferred to a 0.2 ml PCR tube containing 2 μl of lysis buffer (RLT Plus - Qiagen). The tube was immediately placed on a metal plate sitting on top of dry ice for flash-freezing ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA extracts were prepared from a minimum of 2×104 freshly sorted cells using RNeasy Micro Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... and cell pellets were lysed using RLT+ buffer containing 2-Mercaptoethanol using the Qiagen RNeasy+ Micro Kit (Qiagen #74034), following manufacturer’s suggested protocol for RNA isolation ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of the 2-mL culture was removed and replaced by 1 mL of RNAprotect Cell Reagent (Qiagen). After 5 min of incubation ...
-
bioRxiv - Microbiology 2022Quote: ... One volume of bacterial culture containing approximately 0.2 OD600 of cells was mixed with 2 volumes of RNAprotect (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were mechanically disrupted by bead-beating for 2 × 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). The samples were incubated at −80°C for 10 min and at 95°C for 10 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were transfected with a mixture of 2 mg SPACA6 pMT-puro vector and Effectene transfection reagent (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... One half of clarified cell lysate (2 ml) was applied to 200 μl of Ni-NTA Superflow resin (Qiagen) equilibrated with Ni wash buffer (20 mM HEPES pH 8.0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were harvested after 2 hours of treatment and RNA was isolated with the RNeasy Mini Kit (Qiagen #74104). RNA levels were assessed using qScript™ XLT One-Step RT-qPCR ToughMix® (Quanta Bioscience #95132-100 ...
-
bioRxiv - Genomics 2023Quote: MII oocytes and 2-cell embryos were individually lysed and flash-frozen in 5 μl RLT Plus buffer (Qiagen) and stored at −80°C until further use ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were washed 2 times with 1X PBS and RNA was isolated using a RNAeasy Plus Mini Kit (Qiagen).
-
bioRxiv - Biochemistry 2021Quote: ... Samples were incubated at 95°C for 5 minutes and spun down at 17K x g for 10 min to remove cell debris before analysis of raw supernatant was performed via SDS-PAGE using a 12% acrylamide-tris gel and subsequent overnight transfer to a Western blot PVDF membrane and visualization with an anti-His antibody (Qiagen Cat# 34440, RRID:AB_2714179).
-
bioRxiv - Microbiology 2021Quote: ... coli BL21 (DE3) and expression of the His-tagged Cas proteins was performed following the instruction of the protein purification kit (Qiagen, Valencia, CA, USA). Single colonies of transformed cells were cultivated overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... TRAF3 KO1 and TRAF3/p100 double KO cells from 2 experimental repeats was isolated using the RNeasy Mini Kit (Qiagen). RNA quality control was performed using a 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Genomics 2019Quote: Total RNAs from the knockdown (shCTCF#1 and shCTCF#2) and control (shLuc) cells were extracted using miRNeasy Micro Kit (QIAGEN). cDNA was synthesized by using oligo (dT)20 and SuperScript III Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: The commonly up- or downregulated genes in cluster 1 and 2 compared to cluster 0 of untreated MDA-MB-231 cells were subjected to the Ingenuity Pathway Analysis (IPA) (QIAGEN) (Kramer ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from IEC isolations by adding a volume containing 2 x 106 cells in PBS to QIAshredder spin columns (QIAGEN) followed by centrifugation at 9,300 g for 1 min ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 2 to 10 g slices of liver tissue were homogenized in cell lysis solution and proteinase K (Qiagen, Germantown, USA). DNA was extracted from the liver homogenates and resuspended in buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Mitochondria were purified from approximately 2*106 cultured HeLa cells continuously expressing the mitochondrial matrix marker su9-mCherry using the Qproteome Mitochondria Isolation Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... ∼2.5×108 cells (0.5 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from ∼0.5 to 2×106 cells per sample using the RNeasy Plus Mini Kit (Qiagen, 74134) with RNase-free DNase treatment (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated from 3D samples (n=2-3) by combining a TRIzol-based cell lysis with a RNeasy Mini Kit (Qiagen). Samples were collected at aforementioned timepoints ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were seeded in 96-well plates (2 × 104 cells/well) and reverse-transfected with 100 ng/well of Cignal ISRE-Luc reporter (Qiagen) using Lipofectamine 3000 ...
-
bioRxiv - Microbiology 2022Quote: L cell monolayers were disrupted by scraping and pelleted at 200 x g for 5 min before RNA was isolated from 2 x 105 cells using the RNeasy Plus Mini RNA extraction kit (Qiagen) per manufacturer’s protocol.
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genomic DNA was extracted from samples of 2×109 cells after lysis using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... and 675 μL PCR products for control cells and 320 μL were applied to the 2% agarose gel for purification using QIAquick Gel Extraction Kit (QIAGEN). The PCR products of control and sort2 were concentrated by using Amicon Ultra-0.5 10K (UFC501096 ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from individual pools of 1×104 to 2×104 double-sorted SLAM cells using an RNEasy Micro kit (Qiagen). RNA was quantified and quality checked using an Agilent Bioanalyzer 2100 (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... and early stationary phase (OD = 1.0-1.3).1 mL sample of each culture was directly transferred to 2 mL RNAprotect cell reagent (Qiagen, Hilden, Germany). The samples were vortexed 5 sec ...