Labshake search
Citations for Qiagen :
551 - 600 of 817 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: siRNA targeting human GPRC5A (siGPRC5A_4 against target sequence 5′-CTGGGTGTGTTGGGCATCTTT-3′, cat# SI04438021) and non-targeting control siRNA (cat# Ctrl_AllStars_1, target sequence not disclosed) were purchased from Qiagen. Human primary keratinocytes were transfected at 20 nM final siRNA concentration using Lipofectamin 2000 reagent (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was isolated from HEK293T cells 3 days after transfections using the Gentra Puregene Cell Kit (Qiagen) and was diluted to 10 ng/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 0 or 3% CSE-treated bronchospheres using the Qiagen RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Microbiology 2023Quote: ... Individual mosquitoes were homogenized for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). DNA extraction of individual larvae was carried out using the QIAamp DNA Kit (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from 3 dpf zebrafish AB larvae (50 fish) using RNAeasy Plus Kit (Qiagen 74134). cDNA was synthesized using SuperScript IV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted from 3×106 SYAT or CGR8 cells with the Rneasy Plus Mini Kit (Qiagen, #74134). Reverse transcription was performed on 1 µg RNA using oligodT (Thermo Fisher Scientific #SO131 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lower jaws were resuspended in 600 μl of RTL plus buffer supplemented with 1% β-mercaptoethanol (M3148-100ML, MilliporeSigma, Burlington, MA, USA) and Reagent DX (19088, Qiagen, Hilden, Germany). HH31 and HH34 lower jaws were processed in a Bead Mill 24 Homogenizer (15-340-163 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Lower jaws were resuspended in 600 μl of RTL plus buffer supplemented with 1% β-mercaptoethanol (M3148-100ML, MilliporeSigma, Burlington, MA, USA) and Reagent DX (19088, Qiagen, Hilden, Germany). HH31 and HH34 lower jaws were processed in a Bead Mill 24 Homogenizer (15-340-163 ...
-
bioRxiv - Bioengineering 2021Quote: ... 7.5 μL of RNAse free H2O and 10 μL of 2X HotStarTaq™ Plus Master Mix (HotStarTaq™ Plus Master Mix Kit, Qiagen, USA). PCR conditions were an initial denaturation of 5 min at 95°C followed by 25 cycles of 30 s at 95°C ...
-
bioRxiv - Genetics 2024Quote: ... 30 μl clarified lysate were mixed with 70 μl RNase free water and RNA isolated using the RNeasy Mini Kit (Qiagen, Germantown, MA, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA from 3×107 sorted GFP+ cells was extracted using the Blood & Cell Culture DNA Maxi Kit (Qiagen). Amplification of sgRNA regions from the extracted genome and the original sgRNA plasmid library ...
-
bioRxiv - Molecular Biology 2020Quote: ... while method-3 was a modified protocol of the DNeasy PowerMax Soil Kit (Cat.No. 12988-10) provided by Qiagen (based on communication exchanged with the manufacturer) ...
-
bioRxiv - Cell Biology 2019Quote: Transduced GFP+ LT-HSCs from 3 independent biological replicates were sorted directly into 350 ul of RLT buffer (Qiagen). Total RNA was isolated from cells using the RNeasy Micro kit (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was purified from cell passage number 3 using the RNeasy RNA purification kit (Qiagen Cat. No. 75142). A260:280 ratio > 2 and RIN > 9.
-
bioRxiv - Immunology 2021Quote: Bacterial plasmid DNA was extracted from a 3 ml overnight culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Next ...
-
bioRxiv - Microbiology 2020Quote: Each dissected compartment (legs and thoraxes) was homogenized individually 3 x 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tissue samples were homogenized in 3 mL sterile PBS for 20 seconds on ice using a TissueRuptor homogenizer (Qiagen) with sterile tips ...
-
bioRxiv - Genomics 2022Quote: ... 50 ng of total RNA was processed up to 3’ adapter ligation step according to the manufacturer’s instruction (Qiagen). The adapter-ligated RNA was treated with 5U of RppH (New England Biolabs ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted at 3 hpi and 24 hpi with the RNeasy Mini Total RNA extraction kit (Qiagen). SARS-CoV-2 RNA was detected with the CDC assay kit (IDT ...
-
bioRxiv - Bioengineering 2022Quote: ... transfected cells were harvested on Day 3 and genomic DNA was extracted using DNeasy Blood & Tissue Kit (QIAGEN # 69506). The region surrounding EMX1 target site was amplified with EMX1-F ...
-
bioRxiv - Neuroscience 2021Quote: ... miR-67 (miR control) or empty vector at a ratio of 1:3 using a lipofection protocol (Effecten, Qiagen) and processed at DIV15 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were mechanically disrupted by bead-beating for 2 × 3 min at 30 Hz (TissueLyser II, Qiagen, Hilden, Germany). The samples were incubated at −80°C for 10 min and at 95°C for 10 min ...
-
bioRxiv - Cell Biology 2019Quote: ... accordingly to manufacturer’s instructions using non-targeting siRNA (siCtrl; 5’-AATTCTCCGAACGTGTCACGT-3’) and siRNA targeting Cav1 (SI00299635 and SI00299628) from Qiagen, or using pre-miR-NC (negative control ...
-
bioRxiv - Developmental Biology 2019Quote: ... The TSB (5’-ATTATTGCACCCAGTGCC-3’: the miR-92a-3p target site is underlined) was designed and produced by Qiagen, with an additional scrambled TSB to act as a negative control (5’-TAACACGTGTATACGCCCA-3’) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNAs from batch of 3-5 embryos were extracted with the Rneasy® Micro Kit (Qiagen, Valencia CA). Relative quantitative PCR was performed on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was extracted from 3 dpf and 6 dpf cdipt mutant zebrafish and their wildtype siblings using RNAeasy (Qiagen). RNA samples were reverse transcribed into cDNA using the iScript cDNA synthesis kit (BioRad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... using the QIAGEN TissueLyser at 15 Hz for 2-3 min with a Stainless-Steel Bead (QIAGEN catalog # 69989). Phase separation was induced with chloroform ...
-
bioRxiv - Immunology 2019Quote: ... Input material (total cytoplasmic mRNA) and efficiently translated mRNA (heavy polysome-associated, >3 ribosomes) were extracted with QIAzol (Qiagen) and purified using RNeasy MinElute Cleanup Kit (Qiagen) ...
-
bioRxiv - Genetics 2020Quote: ... Seedlings of 3-week-old plants were used to extract total RNAs using the RNeasy Plant Mini Kit (Qiagen). Total RNAs were treated with amplification-grade RNase-free DNase I (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Individual tumors were collected in low binding DNA tubes and digested in 3 μl RLT buffer (Qiagen Cat# 1048449) for 30min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Sample tubes were transferred back to ice before 3 rounds of 60 second bead beating on the TissueLyser2 (Qiagen). Samples were incubated at room temperature for five minutes before 200 µL of chloroform (Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were harvested 3 days later by direct application of buffer RLT from the RNeasy mini kit (Qiagen 74104).
-
bioRxiv - Microbiology 2022Quote: ... homogenized in 500 μl PBS by bead beating (3 mm steel ball, 25 Hz for 2.5 min in a TissueLyser (Qiagen)) ...
-
bioRxiv - Plant Biology 2022Quote: 3 μg total RNA was extracted from each flower bud sample using Tiangen Polysaccharide and Polyphenol Kit (QIAGEN, Germany). After passing the quality inspection ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted from 50-80 mg of surface-sterilised (70% EtOH, 0.1% Triton X-100) and 3-days germinated seeds with RNeasy Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 100 mg of seedlings at 3 dpg by means of the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... The samples were loaded on a EconoSpin column and the RNA was washed 3 times with RPE buffer (QIAGEN). The RNA was eluted with distilled nuclease free water ...
-
bioRxiv - Bioengineering 2024Quote: ... spun down for 15 s at 8,000 g and eluted 3 times by adding 700 µL Buffer RW1 (Qiagen) and spinning ...
-
bioRxiv - Microbiology 2024Quote: ... used for DNA extraction of minipig blood and (NM-3) one negative control for the kit DNeasy PowerWater (Qiagen) used for the DNA extraction of water samples ...
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...