Labshake search
Citations for Qiagen :
551 - 600 of 10000+ citations for Glucose Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Both the input and IP samples were incubated at 50°C for 2 hr and then cleaned up using the Qiaquick PCR Purification Kit (Qiagen, Hilden, Germany, Cat # 28104) and eluted in 35 μL of water.
-
bioRxiv - Systems Biology 2019Quote: RNA was extracted from a total of 17 samples from Experiment 2 with the AllPrep PowerFecal DNA/RNA Kit (Qiagen USA, Cat. No. 80244). The 17 samples included 7 target samples taken during antibiotic treatment (4 untreated and 3 non-responder ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted from the remaining 2 mL of the cell suspension using the RNeasy® Protect Bacteria Mini Kit (QIAGEN, Cat. No. 74524) following the manufacturer instructions.
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was isolated from bulk HSPC samples (∼2 x 106 cells per sample) using a QIAGEN Blood & Tissue DNA isolation kit (QIAGEN, Inc., Germantown, MD, USA) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... In situ hybridization for mature miR-18a was performed using a miRCURY LNA detection probe (Exiqon/Qiagen, Germantown, MD), labeled with DIG at the 5′ and 3′ends ...
-
bioRxiv - Plant Biology 2021Quote: ... and amplification was detected with the ABI PRISM 7700 Sequence Detection System or Rotor-gene Q PCR machine (Qiagen). For normalisation ...
-
bioRxiv - Neuroscience 2022Quote: ... and loaded on RT2 PCR profiler plates (Qiagen, PAHS-078Z). Results were analyzed using the GeneGlobe Data Analysis Center (Qiagen).
-
bioRxiv - Genomics 2020Quote: ... transfected cells were lysed on plate in RLT buffer (Qiagen) and stored at -80°C ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Biochemistry 2022Quote: ... as previously described.10 Detection of 6x His-tagged recombinant POLIB variants was performed with primary antibody Penta•His (1:1000, Qiagen) for one hour ...
-
bioRxiv - Molecular Biology 2019Quote: ... the plasmid DNA of mcr-1-producing Escherichia fergusonii (ICDC-ZG2016M34-3) which was acted as a representative sample for optimization of reaction condition and sensitivity detection was acquired by QIAGEN Plasmid Kits ...
-
bioRxiv - Pathology 2020Quote: ... and the RT product was used for detection of miR-574-5p/3p and control RNA Snord68 using the miScript Primer Assay (Qiagen).
-
bioRxiv - Cell Biology 2022Quote: ... hsa-miR-486 and hsa-Let-7g were quantified by relative quantification using Qiagen LNA based SYBR green detection method (miRCURY LNA miRNA PCR assay-Qiagen). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μL of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplification was performed in 384-well pick&mix plates (Qiagen) with customized selection of 192 LNA-enhance primers to detect 187 endogenous microRNAs and 5 spike-in controls per sample ...
-
bioRxiv - Immunology 2021Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Immunology 2020Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum ...
-
bioRxiv - Immunology 2020Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCL buffer pH 2.7 ...
-
bioRxiv - Physiology 2022Quote: Cells were lysed directly in the plate using Buffer RLT (Qiagen) with 10uL/mL 2-mercaptoethanol following a quick PBS rinse ...
-
bioRxiv - Immunology 2023Quote: ... RT qPCR was conducted with custom array plates (330171, Qiagen, Canada) using the LightCycler 480 Real-Time PCR system (Roche Molecular Systems Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plate was then processed in the PyroMark Q24 pyrosequencer (Qiagen). Results were analyzed with PyroMark Q24 Advanced 3.0.1 software ...
-
bioRxiv - Microbiology 2023Quote: ... and a 96-well PowerMag Glass Bead plate (Qiagen, Hilden, Germany). The Glass Bead Sterilizer was turned on ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCl buffer ...
-
bioRxiv - Genomics 2021Quote: Amplicon libraries for viral genome sequencing were prepared using QIAseq FX DNA Library Kit and QIAseq SARS-CoV-2 Primer Panel (Qiagen, cat. no. 180475, cat. no. 333896) as instructed by the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... double-digoxigenin locked nucleic acid probe (RNO-MIR-124-3P: CATTCACCGCGTGCCTTA, Tm: 84°C, 339111 YD00614870-BGC, miRCURY LNA™ miRNA Detection Probe, Qiagen) was used at a final concentration of 30 nM ...
-
bioRxiv - Cell Biology 2023Quote: ... Reactions were run three times in quadruplicates in the Rotor-Gene Q Real-Time PCR Detection System (QIAGEN, Germantown, Maryland, USA) with the following reaction conditions ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...