Labshake search
Citations for Qiagen :
551 - 600 of 3629 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2× volume of RNAprotect Bacteria Reagent (QIAGEN) for 10 min at room temperature and collected as pellets by centrifugating for 10 min at 5,000×g ...
-
bioRxiv - Genomics 2024Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 ml of RNAprotect® Bacteria Reagent (cat # 76506, Qiagen Inc.) was added ...
-
bioRxiv - Genomics 2020Quote: ... The primer used in the 3’ RACE assay was designed using CLC Genomic Workbench (ver. 10.1.1, Qiagen) near the highest CAGE-Seq signal in the determined TSS region ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 mL were collected and used for plasmid extraction using a QI-Aprep Spin Miniprep kit (QIAGEN). Extracted plasmids were eluted in 30 μL of elution buffer and stored at −20 °C until use.
-
bioRxiv - Bioengineering 2022Quote: Total RNA content was extracted from 3 biological replicates using RNeasy® Plus Mini kit (#74134, Qiagen) following manufacture’s protocol ...
-
bioRxiv - Microbiology 2022Quote: Extraction method 3 used a modified version of the Qiagen QIAamp Mini DNA kit (Qiagen, Venlo, Netherlands). Following initial pelleting ...
-
bioRxiv - Microbiology 2022Quote: ... 1ml of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized for 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then washed 3 x with ice-cold 1x PBS and lysed in RLT buffer (Qiagen) with 1/100 β-mercaptoethanol (Sigma ...
-
bioRxiv - Genetics 2021Quote: Genomic DNA was extracted from an aliquot of 3 × 106 cells using the Gentra Purgene Kit (Qiagen). The genomic region surrounding the CRISPR/Cas9 target site (741 bp ...
-
bioRxiv - Cancer Biology 2023Quote: Small interfering RNA was obtained to knockdown the expression of ARSB and galectin-3 (Qiagen, Germantown, MD). Effects on mRNA were determined by QRT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA (>200nt) was extracted from 400 testes of ≤3 days old flies using miRNeasy Mini column (QIAGEN). For the first replicate ...
-
bioRxiv - Microbiology 2024Quote: ... MRU2687-3 and ZH548 viral stocks were extracted using the QIAmp Viral RNA kit (Qiagen; Courtaboeuf, France) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA was extracted from 3-4 two-week old gemmae using the RNeasy Plant kit (#74903, Qiagen) with RLT buffer supplemented with beta-mercaptoethanol ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant from the second spin was incubated with 3 mL of Ni-NTA agarose beads (Qiagen) for 30 minutes at 4°C in the cold room ...
-
bioRxiv - Bioengineering 2022Quote: ... messenger RNA (mRNA) combined from at least 3 gels were isolated with an RNeasy Mini Kit (Qiagen) and then reverse transcribed into complementary DNA (cDNA ...
-
bioRxiv - Immunology 2022Quote: ... DNA was extracted from frozen cell pellets (3×107 cells; Blood & Cell Culture DNA Maxi Kit, Qiagen) per manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... we transfected the 293T cells at 3 million cells/10 cm dish with Effectene transfection reagent (Qiagen) following manufacturer guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... Tissues were homogenized for five 3-minute cycles of 30 shakes/sec using a TissueLyser II (Qiagen) and transferred to an RNase free microfuge tube (Ambion ...
-
bioRxiv - Cancer Biology 2024Quote: The FASTQ file was analyzed by QIAseq UPX 3’ Transcriptome Primary Quantification tool (QIAGEN GeneGlobe analysis website) to generate gene expression matrix ...
-
bioRxiv - Cell Biology 2024Quote: ... RNase-A was degraded by the addition of proteinase-K (3 mAU/mL, 19131, Qiagen, Hilden, Germany) and inverting the tube briefly ...
-
bioRxiv - Microbiology 2022Quote: ... Organs were homogenized by high-speed shaking in 2 mL microcentrifuge tubes filled with sterile PBS and 5/7 mm stainless steel beads using TissueLyser LT (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: Ticks were homogenised in a 2 ml reaction tube with two 5 mm steel beads and 500 μl PBS using a Tissue Lyser II (Qiagen, Hilden, Germany) for 3 min at 30 Hz ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria were then mechanically disrupted using a bead beater homogenizer (PowerLyzer 24, Qiagen; 2 cycles of 45s 5000 rpm / 5 min ice). After an additional 5 min on ice ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... 120 mg l− 1 sodium pyruvate and 1% penicillin–streptomycin) at 300 Hz for 2 minutes using a TissueLyser II (Qiagen, Germany).
-
bioRxiv - Evolutionary Biology 2022Quote: ... total DNA was extracted from males (N = 5) and females (N = 5) of each genotype using the DNeasy Blood & Tissue kit following manufacturer protocol (Qiagen). Illumina libraries were prepared using the Nextera DNA Flex Library Preparation Kit (Illumina) ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated from 3 months old Pgrcre and FOXL2OE diestrus uteri using RNeasy mini kit (Qiagen). The library was prepared using TruSeq RNA Library Prep kit (Illumina ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-day-old seedlings using a QIAshredder and RNeasy Plus Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1000 µL PBS was added to each sample (lungs, 0.01–0.04 g) along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized at a speed of 10 Hz for 10 min and then centrifuged at 15,000 × g for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were then ground to powder using a 3 mm tungsten carbide bead (Qiagen Cat. No. / ID: 69997) on a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... homogenized in sterile 0.05 % NP40 in H2O for 3 minutes at 25 Hz using a Tissue Lyzer (Qiagen) and serial dilutions were plated on YPD agar containing 100 μg/ml Ampicillin ...