Labshake search
Citations for Qiagen :
551 - 600 of 3924 citations for 6 OXO 1 2 DIHYDRO 6H PYRROLO 3 2 1 IJ QUINOLINE 5 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2-mercaptoethanol and then purified using the RNeasy mini kit (QIAGEN) for the QIAcube connect (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... for Day 0 and 2 analyses or AllPrep DNA/RNA Mini Kit (Qiagen) for Day 4 and 6 analyses ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR-2 products were pooled based on concentrations from capillary electrophoresis (QIAxcel, Qiagen). Final libraries were quantified by Qubit dsDNA High Sensitivity assay (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... The tissue was fully homogenized in 2 ml of QIAzol buffer reagent (Qiagen) on ice and Dounce homogenization ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2024Quote: ... (NM-2) one negative control for the kit DNeasy Blood and Tissue (Qiagen) used for DNA extraction of minipig blood and (NM-3 ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 µl of diluted template cDNA (1:3, nuclease-free water) per real-time PCR reaction (10 µl – SYBR Green PCR kit, Qiagen, 204143) was used to assay specific transcript abundance (CFX96 Real-Time System ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from homogenized lysate containing a range of 3×103 to 1×105 cells per sample using a ll Prep DNA/RNA Mini kit (Qiagen, #80204). RNA was purified and concentrated using RNAClean XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... RAGE-/- and SOD1G93A x RAGE-/- mice (n = 5 - 6) using RNeasy Lipid Tissue extraction kit according to manufacturer’s instructions (QIAGEN, CA, USA). The total RNA was purified from genomic DNA contamination using Turbo DNase treatment (Ambion ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... trigynum (Sample size: L. tenue thrum=6, pin=4, L. trigynum homostyle=5) using the RNeasy Plant Mini Kit (QIAGEN, Germany). Libraries were sequenced on an Illumina NovaSeq S1 Sequencing System to produce paired-end 150bp read length reads ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA from 1-5 million total CD4+ T cells was isolated using the Gentra Puregene Cell Kit (Qiagen) or phenol-chloroform and the DNA concentration was measured by Qubit High Sensitivity Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: The LRH-1-10CA-TIF2 complex was concentrated to 5 mg/mL and screened using the Classics screen (Qiagen) and a Phoenix Liquid Handler (Art Robbins Instruments ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... and run on the RT^2 First Strand Kit (Stem cell PCR array) (Qiagen). The array was run in triplicate (N=3 ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA (2 μg) was extracted from MPB with the RNeasy Mini Kit (Qiagen) and then reverse-transcribed using the First Strand cDNA Synthesis Kit (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from 2×106 human PMNs using the RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 300 mM of NaCl and 2 μL of RNase A (0.5 mg / mL) (Qiagen) were added to the collective eluates which were incubated at 65 °C overnight ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 µg of total RNA were isolated using the Qiagen RNeasy Mini Kit (Qiagen) and further processed in Illumina’s TruSeq Stranded mRNA Library kit (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... the supernatant was applied to 2 mL of pre-washed Ni-NTA resin (Qiagen) at 4°C ...
-
bioRxiv - Biophysics 2021Quote: ... 2 g/ml Biotinylated Anti-His Antibody (Penta-His Biotin Conjugate; Qiagen; No. 34440) in T50 buffer was introduced into flow cells at 50 μl/min ...
-
bioRxiv - Neuroscience 2020Quote: ... and agitated at 30 HZ for twice 2 minutes in the TissueLyser II (Qiagen). RNA isolation was performed on the QIAsymphony (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were then treated with RNase A (2 mg/ml in water, Qiagen, 19101) for 2 hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: The supernatant was mixed with 2 mL Ni-NTA resin (Ni-NTA agarose; Qiagen) pre-equilibrated with buffer A200 (50 mM Tris pH 7.6 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed with 27G1/2 needles and then homogenized with QiAshredder columns (Qiagen). Total RNA from triplicate experiments were purified with the RNAeasy Plus Kit (Qiagen) ...
-
bioRxiv - Systems Biology 2020Quote: ... mechanically homogenized and further lysed in RLT buffer with 2-mercaptoethanol on TissueLyser (Qiagen) with 3 mm beads then extracted according to the protocol using RNeasy Mini Kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... The cleared lysate was run through Ni+2-NTA agarose beads (Qiagen [QA], 30250) to allow binding of the histidine-tagged (recombinant ...
-
bioRxiv - Cell Biology 2021Quote: ... before adding it to 2 ml of Strep-Tactin superflow resin (Qiagen, Hilden, Germany) which was pre-equilibrated with 10 ml lysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... and homogenized for 2 cycles with a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 24 Hz for 3 min each ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM 2-mercaptoethanol) and the proteins eluted from nickel-NTA agarose beads (Qiagen; using buffer containing 25 mM Tris-HCl (pH 7.6) ...
-
bioRxiv - Microbiology 2022Quote: RNA was isolated from 2 x 106 cells using RNeasy plus mini Kit (Qiagen). Reverse transcription was performed with either random decamers or HIV antisense-specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... Lung samples were homogenized with DMEM + 2% FBS in a TissueLyser (Qiagen Inc., CA) operated at 25-30 Hz for four minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cell lysate supernatant was passed through a Ni+2-NTA resin column (Qiagen), and protein was purified following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... 20 mg ground freeze-dried tissue (TissueLyserII Qiagen, Hilden, Germany; 2×45sec, 30 Hz) was used for DNA extraction (DNeasy Plant Mini Kit ...
-
bioRxiv - Cell Biology 2019Quote: ... Rosa26mT/mG 2 weeks after tamoxifen treatment using a miRNeasy Micro Kit (Qiagen, 217084). Library preparation and sequencing were performed by Cedars-Sinai Genomic Core using Illumina NextSeq 500 (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Feces samples were homogenized for 2 min at 25 Hz in a TissueLyzerII (Qiagen) using metal beads ...
-
bioRxiv - Cell Biology 2020Quote: ... CLEC-2-expressing or PDPN KO FRCs were transfected using Attractene Transfection Reagent (Qiagen) with one or both of the following plasmids ...
-
bioRxiv - Immunology 2021Quote: ... The product was run on a 2% gel and purified by gel extraction (Qiagen). Purified product was amplified using primers index3 and index6 ...