Labshake search
Citations for Qiagen :
551 - 600 of 1968 citations for 6 Methyl 4H pyrido3 2 b1 4oxazin 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: Genes were quantified by one-step quantitative reverse transcription-polymerase chain reaction (q-PCR) using the QuantiFast SYBR Green RT-PCR kit (Qiagen, UK). A master mix was prepared by mixing 6.25 μl SYBR green ...
-
bioRxiv - Genomics 2020Quote: ... and from two “normal” males (50289,70203) and one “normal” female (20025) were collected and stored in RNAlater™ (QIAGEN, Hilden, Germany). The normal individuals may be carriers of the genetic variant(s ...
-
bioRxiv - Genetics 2020Quote: ... 1μl of bisulfite converted DNA was used as template to amplify target genomic regions using specific primers (one biotinylated) with the PyroMark PCR kit (Qiagen, #978703), following the recommended conditions (annealing temperature 56°C) ...
-
bioRxiv - Evolutionary Biology 2020Quote: Genomic DNA was extracted from overnight cultures from one isolated colony of each stock following standard protocols (QIAGEN DNAeasy, Hilden, Germany). Extracted DNA was treated with RNase A and purified on Axygen AxyPrep Mag PCR Clean-up SPRI beads ...
-
Global genetic patterns reveal host tropism versus cross-taxon transmission of bat BetacoronavirusesbioRxiv - Evolutionary Biology 2020Quote: ... All RNA extracts were subjected to reverse transcription polymerase chain reaction (RT-PCR) using the one-step RT-PCR kit (Qiagen, USA) and PanCoV F2 (5’-AAR TTY TAY GGH GGY TGG-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... These primers were used to amplify the mRNA from the sample using Quantifast SyBR Green one –step RT-PCR kit (Qiagen, Netherlands) and the reactions were run using ABI 7500 real-time PCR instrument (Thermo Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... Amplification of a single product of the expected size by a primer pair was first confirmed by RT-PCR using Qiagen® One-Step RT-PCR kit (Qiagen) followed by agarose gel analysis of the amplified products ...
-
bioRxiv - Microbiology 2019Quote: ... 1 µM of forward and reverse oligos were heated for one minute at 100°C with 5 mM MgCl2 and 7 mM Tris-Cl (i.e. Qiagen Elution Buffer) and annealed by slowly cooling to room temperature.
-
bioRxiv - Cell Biology 2020Quote: Cells were seeded in 6-well plates at a density of 80,000 cells/well one day prior to transfection and transfected with DR5-AS LNA GapmeR (Qiagen, United States) at a concentration of 40 nM or with 1500 ng of pcDNA3.1-DR5-AS with the Fugene HD transfection reagent (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the sample was divided into 5 parts and each part was purified using one PCR purification columns (PCR purification kit, Qiagen 28106). 50ul elution buffer was used the elute each column ...
-
bioRxiv - Microbiology 2021Quote: The frozen filters were retrieved and cut into two halves using sterile surgical blades and DNA was extracted from one-half using DNeasy PowerSoil Kit (Qiagen, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2022Quote: ... Each of the three reaction pellets were allowed to resuspend in TE for 1 hour at room temperature then pooled into one tube and purified across three Qiaquick PCR purification columns (Qiagen, 28104), eluted in the provided Elution Buffer and combined ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was quantified and qualitatively assessed using a nanodrop instrument following which one step qRT-PCR was performed using QuantiFast SYBR Green PCR kit (204054; Qiagen, Germany). Table 1 lists the primers used for mRNA quantification and cellular glyceraldehyde-3-phosphate dehydrogenase expression was used as a normalizing control ...
-
bioRxiv - Molecular Biology 2020Quote: ... The supernatant was divided into two parts: one part was directly combined with nickel-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen, China); the other part was heated in a 65 °C water bath for 60 minutes and then centrifuged at 14000 rpm for 60 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... while URA3 and ACT1 levels were measured by one-step RT-PCR with specific primers (Supplementary Table S3) following the standard protocol of the RNeasy® Mini kit (Qiagen). All strains were propagated for at least 100 generations before analysis.
-
bioRxiv - Physiology 2020Quote: ... One μg of total RNA was reverse transcribed into cDNA using the Qiagen QuantiTect Reverse Transcription Kit (Qiagen, Valencia, California, USA) following manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 ng of each PCR product was pooled into one tube for purification using the QIAquick PCR purification kit (Qiagen #28106) and eluted into 30 µL Nuclease Free Water ...
-
bioRxiv - Genomics 2020Quote: ... high-molecular weight DNA was extracted from the entire body of one F1 pupa using a QIAGEN Blood & Culture DNA Midi Kit (Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was recovered from one-month-old of the DL1YTT001 culture by using a RNeasy® PowerSoil® kit (Qiagen). The kits mentioned above were used according to manufacturer protocols.
-
bioRxiv - Physiology 2023Quote: ... A one-step real-time quantitative polymerase chain reaction (RT-qPCR) was performed using a QuantiFast SYBR Green RT-PCR one-step kit on a Rotorgene 3000Q thermocycler (Qiagen, UK). Each reaction was setup as follows ...
-
bioRxiv - Microbiology 2023Quote: Total DNA was isolated from the whale blow and technical control samples in one batch using a QIAamp DNA Mini Kit (QIAGEN, Germany). The primers used for sequencing the 16SrRNA V3 and V4 regions were 341F (5’-CCTACGGGNGGCWGCAG ...
-
bioRxiv - Developmental Biology 2023Quote: DNA from two separate stage 42 embryos of F0 Cab and F0 Kaga and one stage 42 embryo of F1 hybrid Kaga/Cab was extracted using DNeasy Blood and Tissue Kit (Qiagen #69504) following the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were seeded at 3 × 105 cells.well−1 in 6-well plates and transfected 24 h later with one pmiRGLO derivative construct per well (0.9 µg plasmid) using Effectene (Qiagen cat. #301425). After 3 days the cells were washed with PBS and lysed with Cell Culture Lysis Buffer (Promega cat ...
-
bioRxiv - Neuroscience 2023Quote: ... One well of a 60-80% confluent 12-well was harvested with 700 μl QIAzxol Lysis Reagent (Qiagen; Cat. No. 79306) for subsequent RNA extraction with RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2024Quote: We extracted DNA from one of the two duplicate swabs using a modified version of the DNeasy® Blood and Tissue kit (QIAGEN) optimized to recover DNA from swabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 katna1-/-MZ and one pool of 10 wild-type embryos (at 24 hpf) using the RNeasy Mini-kit (Qiagen, France) and reverse-transcribed using the Superscript RT II Kit with random hexamers (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Developmental Biology 2019Quote: RNA was extracted from pools of 6 × 105 FACS-isolated cells using the miRNeasy Micro Kit (Qiagen). Quantification of total RNA was performed by Qubit® RNA BR Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected in 10 cm2 or 6-well plates at ∼60% confluency using PolyFect (Qiagen 301107) and washed with complete media 6 h later.
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA (at least 6 μg) was extracted using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany), with an additional step to remove contaminating DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Molecular Biology 2020Quote: SH-SY5Y cells plated in 6-well plates were lysed using 750ul of QIAzol Lysis reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... GAS and SOL muscles from 6 mice per group were pulverized and lysed in RLT buffer (Qiagen) and treated with proteinase K (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR cycles were run as described elsewhere 6 but using a Rotor Gene-Q instrument (QIAGEN, GER). To quantify the relative abundance of Cori and ter chromosomal regions in each sample ...
-
bioRxiv - Immunology 2022Quote: BMDMs were grown in 6-well plates and RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA from cardiomyocytes was obtained on day 6 post adenovirus infection using the RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from cortical neurons on 6 cm dishes using RNeasy Plus Mini Kit (QIAGEN, 74134) and reverse-transcribed using SuperScript II (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: Amplification was carried out in a Rotor Gene thermocycler 6-plex with Quantitect Multiplex PCR kit (Qiagen) with 0,24μM of each primer y 0,25μM of each probe under the following conditions ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... gDNA was purified from cells in 6-well plates using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Fibroblasts were grown to confluency in 6-well plates and total RNA extracted using RNeasy Kit (Qiagen). Poly(A)-tailed RNA enrichment and library construction was performed using KAPA stranded mRNA-Seq Kit with KAPA mRNA capture beads (KAPABiosystems) ...