Labshake search
Citations for Qiagen :
551 - 600 of 3689 citations for 6 Chloro 4 hydroxy 2 methyl 2H thieno 2 3 e 1 2 thiazine 3 carboxylic acid methyl ester 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Rosa26mT/mG 2 weeks after tamoxifen treatment using a miRNeasy Micro Kit (Qiagen, 217084). Library preparation and sequencing were performed by Cedars-Sinai Genomic Core using Illumina NextSeq 500 (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Feces samples were homogenized for 2 min at 25 Hz in a TissueLyzerII (Qiagen) using metal beads ...
-
bioRxiv - Cell Biology 2020Quote: ... CLEC-2-expressing or PDPN KO FRCs were transfected using Attractene Transfection Reagent (Qiagen) with one or both of the following plasmids ...
-
bioRxiv - Immunology 2021Quote: ... The product was run on a 2% gel and purified by gel extraction (Qiagen). Purified product was amplified using primers index3 and index6 ...
-
bioRxiv - Immunology 2021Quote: ... The product was run on a 2% gel and purified by gel extraction (Qiagen). Purified product was amplified using primers index3 and index4 ...
-
bioRxiv - Immunology 2021Quote: ... PCR products were run on 2% agarose gels and purified by gel extraction (Qiagen). Purified barcode and gene products were combined with linearized yeast-display vector (pDD003 digested with EcoRI and BamHI ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was detected using One-step probe RT-qPCR kits (Qiagen) run on the CFX96 detection system (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RNA was detected using One-step probe RT-qPCR kits (Qiagen) run on the CFX96 detection system (Bio-Rad) ...
-
bioRxiv - Genetics 2020Quote: ... 2 µL of bisulfite-converted DNA were amplified with the HotStartTaq DNA Polymerase (QIAGEN) and primers containing internal barcodes using following conditions ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 3.2 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 30 r/s for 3 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... collected in DMEM with 2% serum and homogenized using a Tissue-Lyser II (QIAGEN). Samples were centrifuged at 8,000 rpm for 8 minutes and viral titers were quantified using a plaque assay as described above ...
-
bioRxiv - Developmental Biology 2023Quote: 2 μg of genomic DNA was bisulfite treated using the EpiTect Bisulfite Kit (Qiagen) and eluted in 20 μL of 1:10 of the supplied EB buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... Homogenization was performed with 2 tungsten beads using a Tissue Lyser (Qiagen, cat# 85300) run at 30 cycles/sec ...
-
bioRxiv - Genetics 2020Quote: ... 1 µl 1 mg/ml Carrier RNA (QIAGEN), 1 µl 10% SDS ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... a cancer associated fibroblast (CAF) cell line (pCAF2) expressing TGF-β responsive SMAD2/3/4 RE-Luciferase (Qiagen, #CLS-017L) was created ...
-
bioRxiv - Immunology 2022Quote: ... Kidneys were mechanically disrupted with metal beads during 3 min at 4°C and DNA was then extracted using QIAmp DNA kit (Qiagen). Leptospiral DNA was specifically targeted using primers and probes designed in the lpxA gene (L ...
-
bioRxiv - Cancer Biology 2022Quote: 3 Type D and 3 Type V SCLC tumor-derived cell lines were treated with either vehicle (EtOH) or 4-OHT for 3 days and RNA was isolated using the RNeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: Genome DNA was extracted from each cell line every 3 – 4 days after transfection or transduction using DNeasy Blood and Tissue Kit (QIAGEN) per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Cell Biology 2021Quote: Total RNA from HGC (3 x 107 cells) and SPZEJ (3-30 x 107 cells) was extracted with the RNeasy Plus Mini Kit (Qiagen), and the purity and concentration of the extracted RNA was evaluated with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Molecular Biology 2019Quote: ... or from 1 mL plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN, Cat. No.: 55114, QC for short) following the manufacturer’s guide ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 2 hours we extracted the total RNA (RNeasy mini kit, Qiagen, cat. n. 74104) from 40 animals for each of the 3 experimental replicates (total ...
-
bioRxiv - Cell Biology 2020Quote: RNA from 2×107 cells was isolated using the RNeasy Mini Kit (Qiagen, Venlo, Netherlands), cDNA was generated by reverse transcription on CFX96 real-time system (BioRad ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 2 μl sucrose purified virus using the RNeasy mini kit (QIAgen). The RNA was then treated with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... and tissue homogenized for 2 min at 30 Hz in a TissueLyser II (Qiagen, NL). cDNA was produced by reverse transcribing 3 µg of RNA using superscript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by 2 minutes (40 oscillation per second) on a bead shaker (Qiagen Tissue lyser)-centrifuged at 1000g for 5 minutes at 4 °C to remove debris ...
-
bioRxiv - Molecular Biology 2020Quote: ... and gonad were collected and stored separately in 2-mL tubes containing RNA later (QIAGEN) overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was isolated from 2-week-old plant leaves using RNeasy Mini Kit (QIAGEN) Germany ...
-
bioRxiv - Microbiology 2019Quote: ... and the supernatant was applied to 2 mL of pre-washed Ni-NTA resin (Qiagen) at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... coli* culture from each growth condition were stabilised in RNAProtect Bacteria Reagent (2 mL; Qiagen) and cells pellets were frozen at −80°C prior to processing ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Bioengineering 2021Quote: ... the obtained soluble extract was mixed with 2 ml slurry Ni-NTA beads (30210, QIAGEN), incubated at 4 °C for 2 h with rotation.
-
bioRxiv - Biochemistry 2021Quote: ... the obtained soluble extract was mixed with 2 ml slurry Ni-NTA beads (30210, QIAGEN), incubated at 4°C for 2 h with rotation ...