Labshake search
Citations for Qiagen :
551 - 600 of 1438 citations for 2 Chloro 4 fluoro 4' pyrrolidinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2024Quote: ... 2 ml RNAprotect Bacteria Reagent (Qiagen, Hilden) was added to each filter and incubated for 15 min at room temperature before vacuuming through the filter ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl Proteinase K (Qiagen, RP107B-1) and 5 µl water was added to each tube with 5 µl sub-library for a final volume of 20 µl per reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... and SFPQ siRNA #2 (Qiagen Cat#SI05783876) at 40 nM using Lipofectamine RNAiMax transfection reagent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... U6 snRNA (2 nM-positive control; Qiagen) or scramble control probe (40 nM – negative control ...
-
bioRxiv - Cell Biology 2020Quote: One colony per clone corresponding to ∼2×104 cells and 2×103 primary cells of each individual were lysed in RLT Plus (Qiagen) and stored at −80°C until processing ...
-
bioRxiv - Neuroscience 2021Quote: Total brain RNA from 21 days old Itm2bD/D and Itm2bww/ rats (2 male and 2 females per each genotype) was extracted with RNeasy RNA Isolation kit (Qiagen). Standard RNA-Seq procedures and data analysis was performed by Genewiz following proprietary methods (https://cdn2.hubspot.net/hubfs/3478602/NGS/RNA-Seq/GENEWIZ_RNA-Seq_Technical_Specifications_US.pdf) ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... were homogenized in 2-mL tubes containing lysis buffer plus 1% 2-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless-steel beads (Qiagen #69989 ...
-
bioRxiv - Microbiology 2021Quote: Swab RNA was extracted from 0.2 ml of swab solutions (1ml of DMEM with 2% fetal bovine serum [Cytiva]) using QIAamp Viral RNA Minikit (QIAGEN) and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated from cultures infected with rVSV/SARS-CoV-2/GFP1D7 and rVSV/SARS-CoV-2/GFP2E1 using the QIAamp Viral RNA mini kit (Qiagen) and cDNA synthesis was performed using SuperScript III using hexamers (ThermoFisher) ...
-
bioRxiv - Genetics 2021Quote: ... ThermoScientific catalog numbers A32955 and 78420)) using a bead mill with steel beads (2 x 2 min at 20 Hz; TissueLyser, Qiagen). Extracts were cleared by centrifugation (17,000 RCF ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from control (n = 2) and olaparib-treated (n = 2) GTFB-PDX1009 ascites using the RNeasy Plus Mini kit (Qiagen). RNA quality was confirmed using an Agilent TapeStation and all RNA used for library preparation had a RIN>9 ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Molecular Biology 2024Quote: ... Frozen tumor cryosections were homogenized with the TissueLyser mixer-mill disruptor (2 x 2 min, 25 Hz, Qiagen, Hilden, Germany). The quality of total RNA was assessed with an Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kit (Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We carried out four separate extractions from spleen (N=2) and liver (N=2) tissue with MagAttract HMW DNA Kit (QIAGEN). We also performed a fifth extraction with spleen tissue using Monarch® HMW DNA Kit (New England BioLabs ...
-
bioRxiv - Systems Biology 2024Quote: ... K56-2 pcepI-lux and K56-2 ΔcciIR pcepI-lux was extracted using the DNeasy UltraClean Microbial Kit (Qiagen S.r.l). Whole genome shotgun sequencing (2 x 150 bp ...
-
bioRxiv - Genomics 2024Quote: ... Frozen lung cryosections were homogenised with the TissueLyser mixer-mill disruptor (2 x 2 min, 25 Hz, Qiagen, Hilden, Germany). The quality of total RNA was assessed with an Agilent 2100 Bioanalyzer and Agilent RNA 6000 Nano Kit (Agilent Technologies ...
-
bioRxiv - Genomics 2020Quote: ... cells were mixed 1:2 with RNAProtect (Qiagen) and harvested via centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... Samples were treated with 2 µg RNaseA (Qiagen) and DNA was purified using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and Mm Aldoa 2 FlexiTube siRNA (Qiagen, SI00896238) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... 2 ml of Ni-NTA Agarose (Qiagen, 30310) was added per 50 ml of supernatant and the mix was left on a rolling platform at 4°C overnight ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 2) DNeasy Blood and Tissue Kit (Qiagen, Germany); 3 ...
-
bioRxiv - Biochemistry 2022Quote: 2 mL of Ni-NTA resins (Qiagen, USA) were packed into a 5 mL column ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Molecular Biology 2024Quote: ... with Negative Control GapmeR A (30300019-2, Qiagen) using 3.5 μL of Lipofectamine 2000 in Opti-MEM I reduced serum medium following the manufacturer’s suggested protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 7.5 (Invitrogen #15567027)] in a 2 mL sample tube (Qiagen #990381) and a 5 mm stainless steel bead (Qiagen #69989 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µl of RNAse A (Qiagen; Cat. 19101) and 2 µl DNAse I (Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA from Arabidopsis seedlings (Col-0, sphk1-2, SPHK1-KD and gcs-2) were extracted using RNeasy® Plant Mini Kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... upwards was isolated from two different clones of pBABE-SAOS 2 and hTERT-SAOS 2 stable cell lines by using miRNeasy Mini Kit (Qiagen, #79306), following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by RNA extraction with TRIzol using Tissue Lyser II (30 Hz frequency for 2 min with 2 cycles, Qiagen, Germany). Equal amounts of RNA from each sample were reverse transcribed in 20 μl to produce cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using the QIAseq SARS-CoV-2 Primer Panel V2 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using QIAseq SARS-CoV-2 Primer Panel V1 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 x 2 minute intervals at 25 Hz with the addition of one 7 mm stainless steel bead (Qiagen #69990). 200 uL of tissue lysate was used for KingFisher Flex (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from d2 (n. 2 biological replicates) and d4 (n. 2 biological replicates) cells with QIAzol lysis reagent (Qiagen #79306), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: Approximately 10 to 20 mg of frozen muscle was homogenized 2 times for 2 minutes at a speed of 30 Hz with a TyssueLyser instrument (Qiagen, Canada) in an ice-cold lysis buffer (1:20 ...
-
bioRxiv - Developmental Biology 2024Quote: ... individual offspring and diet samples were homogenized in 200 µL Optima™ water for 2 x 2 min at 25 Hz using a TissueLyser bead mill (QIAGEN), and then an aliquot of methanol (200 µL ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were homogenized in 300 µL Optima™ water for 2 x 2 min at 25 Hz using a TissueLyser bead mill (QIAGEN). Another 650 µL Optima™ water was added ...
-
bioRxiv - Immunology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Biophysics 2020Quote: ... 2 mM PMSF) on a Ni-NTA resin (Qiagen). Bound proteins were washed (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... then diluted to 2 nM using elution buffer (Qiagen) containing 0.1% Tween20 (Sigma) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a 3:2 mixture of QG buffer (QIAGEN) and isopropanol ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... the 2 proteases of proteinase K (Qiagen, Hilden, Germany) and dispaseII (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl Qiagen CL buffer (10x; Qiagen, Hilden, Germany), 0.4 µl MgCl2 (25 mM ...