Labshake search
Citations for Qiagen :
551 - 600 of 2222 citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... then 5 µl of RNAse A (10 mg/ml; Qiagen, Hilden, Germany) was added and the sample was incubated for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... a proteinase K reaction solution containing 5 μL of PKD buffer (QIAGEN) and 0.31 μL of ProK (QIAGEN ...
-
bioRxiv - Neuroscience 2022Quote: ... one 5 mm bead per sample was used in a TissueLyser (Qiagen) for 4 min at 30 Hz ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg/mL DNase I and 200 µg/mL RNase A (Qiagen). Followed by a mild sonication (10 strokes ...
-
bioRxiv - Microbiology 2023Quote: ... maintained on ice and homogenized using 5 mm stainless steel beads (Qiagen) on a minibeadbeater (BioSpec ...
-
bioRxiv - Microbiology 2023Quote: ... Harvested cells were fixed overnight in 5 mL RNA Protect reagent (Qiagen) after incubation with compounds ...
-
bioRxiv - Microbiology 2023Quote: ... 5-10g of peat materials (preserved in Lifeguard soil preservation solution, Qiagen) was added into bead tubes ...
-
bioRxiv - Biochemistry 2022Quote: ... and purified by affinity chromatography using a 5 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Bioengineering 2023Quote: ... on a 5-plex QIAcuity One digital PCR instrument (911021, Qiagen, USA). The thermal cycling conditions were implemented using the following program ...
-
bioRxiv - Cancer Biology 2023Quote: ... we manually dispensed 5 μL of Vapor-Lock (Qiagen, cat. no. 981611) into each well in the targeted region of a 384-well plate ...
-
bioRxiv - Biophysics 2024Quote: ... corresponding to ∼5 L per sample (RNeasy PowerSoil Total RNA Kit; Qiagen). The RNA was tested with Bioanalyzer ...
-
bioRxiv - Microbiology 2024Quote: ... 5 PCRs were pooled and purified on one Qiaquick spin column (Qiagen) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... 5 ml of the culture was mixed with RNAprotect Bacteria Reagent (QIAGEN) at a 1:2 ratio ...
-
bioRxiv - Microbiology 2024Quote: ... (5) DNA was purified after reverse crosslinking using a MinElute column (Qiagen) as directed and quantified by a Qubit fluorometer (Invitrogen).
-
bioRxiv - Evolutionary Biology 2024Quote: ... trigynum homostyle=5 individuals) using the RNeasy Plant Mini Kit (QIAGEN, Germany). Libraries were sequenced on an Illumina NovaSeq S1 Sequencing System to produce paired-end 150bp read length reads ...
-
bioRxiv - Cell Biology 2024Quote: ... or p300 (Qiagen, Sequence: 5′-TAG TCT GGT CCT TCG T-3′) for 24hr ...
-
bioRxiv - Genomics 2024Quote: ... 1 µL (50U) of high-concentration klenow 3’-5’ exo-polymerase (Qiagen) was added ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 μL sample) were run in duplicates in a Rotor-Gene Q machine (QIAGEN) using the appropriate primer pairs.
-
bioRxiv - Neuroscience 2021Quote: ... and 4 were resuspended each in 117 µL of Lysis Buffer RLT Plus (Qiagen), vortexed ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C until DNA preparation using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacture’s recommendation ...
-
bioRxiv - Microbiology 2022Quote: ... the Qiagen MagAttract PowerSoil DNA Isolation Kit (Cat#: 27000-4-KF; Qiagen, Carlsbad, CA), against five other extraction kits ...
-
bioRxiv - Plant Biology 2021Quote: ... and purified with the MiniElute PCR purification kit (QIAGEN, Cat. No. / ID: 28006×4). The purified genomic DNA fragments were end-repaired and had an A-tail added to the 3’ end ...
-
bioRxiv - Molecular Biology 2020Quote: ... thaliana were homogenised with zirconia beads YTZ-4 and TissueLyser II (Qiagen, Hilden, Germany), and total RNA was then extracted using the Maxwell 16 LEV Plant RNA Kit (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Immunology 2023Quote: ... Larvae were euthanized at 4°C overnight and homogenized with a tissue lyser (Qiagen) at 1800 oscillations/min (30 Hz ...
-
bioRxiv - Bioengineering 2024Quote: ... and was then subjected to Ni-NTA affinity purification at 4 [(Qiagen, Valencia, CA). The column was adequately washed with 20 column volume of wash buffer containing 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was collected and incubated with 4 ml of Ni-NTA agarose (Qiagen) for 2 hours at 4° C ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed and RNA was extracted from 4×106 cells using the RNeasy kit (Qiagen) (performed in triplicate) ...
-
bioRxiv - Neuroscience 2023Quote: ... and tissue was homogenized at 4°C in a tissue lyser bead mill (Qiagen) for 2 min at 20 Hz ...
-
bioRxiv - Biophysics 2023Quote: ... 4 °C and the supernatant was loaded onto a NiNTA column (Qiagen, Hilden, Germany) previously equilibrated with washing buffer (20 mM Tris pH 8 ...
-
bioRxiv - Cell Biology 2024Quote: ... treatment or remission serums (n = 4 repeats/condition) using the RNEasy plus kit (Qiagen). Libraries were generated with the KAPA mRNA HyperPrep Kit (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...