Labshake search
Citations for Qiagen :
5751 - 5800 of 10000+ citations for Rat Palmitoyl Protein Thioesterase 1 PPT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and purified using RNeasy Minelute RNA cleanup kit (Qiagen). RNA quality was assessed using microcapillary electrophoresis on Agilent 2100 Bioanalyzer with RNA Pico 6000 kit (Agilent ...
-
bioRxiv - Genetics 2024Quote: ... primarily the Qiagen DNEasy Blood and Tissue kit (www.Qiagen.com) and the GenElute Mammalian Genomic DNA Miniprep kit (www.sigmaaldrich.com ...
-
bioRxiv - Immunology 2024Quote: ... RNA was extracted using the RNeasy Micro kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Genomics 2024Quote: ... Genomic DNA was extracted with the MagAttract kit (Qiagen) and Nanopore libraries were built with the Rapid barcoding kit (SQK-RBK114.24 ...
-
bioRxiv - Genomics 2023Quote: ... using the DNAeasy Blood & Tissue Kit (QIAGEN, Valencia, CA) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Amplicons were purified with QIAquick PCR Purification Kit (Qiagen) before Sanger sequencing ...
-
bioRxiv - Genomics 2024Quote: ... 100 DNA extractions (Qiagen QIAamp Fast DNA Stool kit) from clinical samples from Prof ...
-
bioRxiv - Immunology 2024Quote: ... and RNA was extracted using the miRNeasy kit (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... DNase treatment was performed using RNeasy DNase kit (Qiagen) and protocol ...
-
bioRxiv - Immunology 2024Quote: RNA was extracted using the RNAeasy Micro kit (Qiagen) according to manufacturer’s instructions from Treg cells (sorted as CD4+Foxp3GFP+RFP+CD62L+ from Foxp3-GFP-hCre;Ezh2Y641F/+;R26RFP or Foxp3-GFP-hCre;Ezh2+/+;R26RFP mice ...
-
bioRxiv - Genomics 2024Quote: ... RNA was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... using the Qiagen RNeasy mini kit (Qiagen, Hilden, Germany) and treated with DNase I (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... aeruginosa PA14 using the RNAeasy kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... KPctrl and KPneo cells using RNeasy Mini kit (Qiagen) (3 samples/condition ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was extracted using the RNeasy Mini Kit (Qiagen), and genomic DNA was removed using the TURBO DNA-free kit (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... The HotStartTaq® Plus Master Mix Kit (QIAGEN, Germany) was used for PCR and the amplification cycle included initial denaturation at 95°C for 5 minutes ...
-
bioRxiv - Immunology 2024Quote: Cellular RNA was isolated using the RNeasy kit (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Immunology 2024Quote: ... Cellular RNA was isolated with the RNeasy kit (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Microbiology 2024Quote: ... we followed the QIAamp DNA stool mini kit (Qiagen)-based protocol described by Knudsen et al ...
-
bioRxiv - Bioengineering 2023Quote: ... and purified with the MinElute Gel Extraction Kit (Qiagen). For each sample ...
-
bioRxiv - Cell Biology 2024Quote: ... utilizing the RNeasy Plus Mini kit (Qiagen, Hilden, Germany). Reverse transcription was carried out using the iScript cDNA Synthesis Kit (BIO-RAD ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were purified using MiniElute PCR purification kit (Qiagen) and eluted in 10 µl of elution buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... and purified using the miRNeasy micro kit (Qiagen, 217084) with on-column DNase I treatment (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: RNA was extracted employing the RNeasy kit (Qiagen, Germany). For mRNA detection ...
-
bioRxiv - Genomics 2023Quote: ... or with the QIAquick PCR Purification Kit (Qiagen, 28106) with 30 µL elution buffer.
-
bioRxiv - Physiology 2023Quote: ... RNA was isolated using RNeasy Mini Kit (Qiagen #74106) according to manufacturer’s instructions ...
-
Convergence, plasticity, and tissue residence of regulatory T cell response via TCR repertoire prismbioRxiv - Immunology 2023Quote: ... RNA purification from individual samples (RNeasy Micro Kit, Qiagen), TCR library preparation from cDNA and Library Next Generation Sequencing has been previously described18.
-
bioRxiv - Cancer Biology 2024Quote: ... vectors were prepared using the EndoFree-Maxi Kit (Qiagen) and resuspended in a sterile 0.9% NaCl solution/plasmid mix containing 10 μg of pT3-MYC (Addgene #92046) ...
-
bioRxiv - Biochemistry 2024Quote: ... and purified using a QIAquick Gel Extraction Kit (Qiagen). The forward PCR primer (5’-GAAAAACTGGATCGTCTGAAAGCCCGGGCTTAAGGATAAGAACTAACGTGATTCC GGGGATCCGTCGACC-3’ ...
-
bioRxiv - Bioengineering 2024Quote: ... genomic DNA was isolated using a DNeasy kit (QIAGEN). Indels were identified by PCR of the region of interest (Tables S3) ...
-
bioRxiv - Bioengineering 2024Quote: ... homogenization columns and isolation kits were purchased from Qiagen. Bioanalyzer chips and reagents were purchased from Agilent ...
-
bioRxiv - Bioengineering 2024Quote: ... RNA was extracted using an RNeasy Mini Kit (Qiagen) and the concentration was evaluated with a NanoDrop OneC (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Ni-NTA Agarose (part of QIAexpress Kits, Qiagen (Germany) was used.
-
bioRxiv - Biochemistry 2023Quote: ... MN (Germany) or Plasmid Midi kits from Qiagen (Germany).
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated using RNeasy Plus Mini Kit (Qiagen), and cDNA was prepared using Superscript First Strand Synthesis System for RT-PCR Kit (Biorad ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was isolated using the RNeasy kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA was isolated using QIAamp DNA kit (Qiagen) and used for DNA methylation profiling.
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted using RNeasy micro-kit (Qiagen) following manufacturer’s procedures ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was extracted using the RNeasy Micro kit (Qiagen) following the manufacturer’s recommendations ...
-
bioRxiv - Synthetic Biology 2023Quote: ... overnight and PCR purified (Qiagen QIAQuick PCR Purification Kit) the following day ...
-
bioRxiv - Genomics 2023Quote: We used the DNEasy Blood and Tissue Kit (Qiagen) to extract 5 ug DNA from the GM12878 lymphoblastoid cell line ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was purified using QIAquick PCR Purification Kit (QIAGEN).
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using the DNeasy PowerSoil Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated using the miRNeasy Mini Kit (Qiagen) and cDNA was synthesized using SuperScript IV Reverse Transcriptase ...
-
bioRxiv - Microbiology 2023Quote: The QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany) was used for the DNA extraction of FFPE embedded tissue sections ...
-
bioRxiv - Microbiology 2023Quote: ... the RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany) was applied and a DNase digestion was carried out by using the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... gel purified using the QIAquick Gel Extraction Kit (Qiagen), ligated with phosphorylated oligonucleotides ...
-
bioRxiv - Immunology 2023Quote: ... RNA isolation was performed using RNeasy Mini Kit (Qiagen) and was quantified using a Qubit 4 fluorometer (ThermoFisher) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were processed for RNA (RNeasy micro kit, Qiagen) and reverse transcribed to cDNA (SuperScript First Strand Synthesis Kit for RT-qPCR ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was extracted using RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions and converted to cDNAs employing RT2 HT First Strand cDNA Kit (Qiagen) ...