Labshake search
Citations for Qiagen :
5601 - 5650 of 10000+ citations for C Reactive Protein ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was isolated using the RNeasy kit (Qiagen) and then treated with DNase I by using the DNase treatment and removal kit from Ambion ...
-
bioRxiv - Neuroscience 2022Quote: ... plasmids were extracted with QIAprep Spin Miniprep kit (Qiagen). The cloned gene was verified by DNA sequencing (Berkeley Sequencing Facility).
-
bioRxiv - Molecular Biology 2022Quote: ... and then purified using QIAquick PCR purification kit (Qiagen).
-
bioRxiv - Microbiology 2022Quote: ... and total RNA isolated using the RNeasy Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... using the QIAamp RNA Blood kit (Qiagen, Hilden, Germany), and cDNA synthesis was performed from 2 µg of total RNA using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... After tagmented DNA was purified using MinElute kit (Qiagen), two sequential PCR were performed to enrich small DNA fragments ...
-
bioRxiv - Plant Biology 2022Quote: ... using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... purified using a RNeasy Mini Kit (Qiagen, Valencia, CA) and siRNAs were generated by using the Block-iT Dicer RNAi kit (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted with the RNeasy kit (Qiagen). cDNA from RNA was synthesized with the qScript cDNA Supermix (Quantabio) ...
-
bioRxiv - Physiology 2022Quote: ... RNA was cleaned with an RNeasy Mini Kit (Qiagen). Complementary DNA was synthesized using a Superscript III reverse transcriptase (Invitrogen ...
-
ZMYM2 is essential for methylation of germline genes and active transposons in embryonic developmentbioRxiv - Molecular Biology 2022Quote: ... or AllPrep DNA/RNA Micro Kit (Qiagen-CAT# 82084). mRNA was reverse transcribed with MMLV (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... QIAseq FastSelect -rRNA HMR kit reagent (Qiagen cat# 334386) was added to the first strand cDNA synthesis reaction according to manufacturer’s instructions with the exception that only one tenth the amount was used for the majority of libraries ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was extracted by a RNeasy Kit (Qiagen, 74106), and cDNA was synthesized using SuperScript VILO cDNA kit (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: RNA was isolated by RNeasy Plus Mini Kit (Qiagen). Yield and purity was measured by Nanodrop 2000 (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: ... and maxiprepped (Plasmid Plus Midi or Maxi Kit, Qiagen) for further use ...
-
bioRxiv - Immunology 2022Quote: ... and were purified using RNeasy Mini Kit (Qiagen, #74106). Cas9 mRNA was synthesized using mMESSAGE mMACHINE® SP6 Transcription Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted using the RNeasy Isolation Kit (Qiagen) according to the manufacturers’ protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... purified RNA using RNeasy Mini Kit (Qiagen, Germantown, MD), reverse-transcribed it with qScript cDNA Synthesis Kit (QuantaBio ...
-
bioRxiv - Cell Biology 2022Quote: ... and extracted using a plasmid midiprep kit from Qiagen. The plasmids used in this study were ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by RNA extraction (RNeasy Mini Kit, Qiagen, #74104) and sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... and isolated using the RNeasy Mini Kit (Qiagen, 74104) with RNase-Free DNase (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: RNA was isolated using the RNeasy mini Kit (QIAGEN) and genomic DNA was removed using the RNase-Free DNase Set (QIAGEN) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PolyA selected RNA was isolated using Oligotex kit (QIAGEN) and further processed with SMARTer Stranded RNA-Seq Kit (Takara ...
-
bioRxiv - Microbiology 2024Quote: ... using the QIAamp DNA Mini Kit (Qiagen, Germantown, MD) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The DNeasy® PowerFood® Microbial Kit (QIAGEN, Germany) was used following the manufacturer’s instructions with minor exceptions ...
-
Assessment of salivary microRNA by RT-qPCR: Challenges in data interpretation for clinical diagnosisbioRxiv - Molecular Biology 2024Quote: Reverse transcriptase reactions using miRCURY LNA RT Kit (Qiagen) for synthetic and/or purified salivary miRNA were prepared in 96 well plates ...
-
bioRxiv - Synthetic Biology 2024Quote: ... gel extractions using the QIAquick Gel Extraction Kit (QIAGEN) and PCR clean-up reactions using the MinElute PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Biochemistry 2023Quote: ... Ni-NTA Agarose (part of QIAexpress Kits, Qiagen (Germany) was used.
-
bioRxiv - Biochemistry 2023Quote: ... MN (Germany) or Plasmid Midi kits from Qiagen (Germany).
-
bioRxiv - Bioengineering 2024Quote: ... RNA was extracted using an RNeasy Mini Kit (Qiagen) and the concentration was evaluated with a NanoDrop OneC (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated using RNeasy Plus Mini Kit (Qiagen), and cDNA was prepared using Superscript First Strand Synthesis System for RT-PCR Kit (Biorad ...
-
bioRxiv - Cell Biology 2023Quote: RNA was extracted employing the RNeasy kit (Qiagen, Germany). For mRNA detection ...
-
bioRxiv - Cell Biology 2023Quote: ... and purified using the miRNeasy micro kit (Qiagen, 217084) with on-column DNase I treatment (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... or with the QIAquick PCR Purification Kit (Qiagen, 28106) with 30 µL elution buffer.
-
bioRxiv - Physiology 2023Quote: ... RNA was isolated using RNeasy Mini Kit (Qiagen #74106) according to manufacturer’s instructions ...
-
Convergence, plasticity, and tissue residence of regulatory T cell response via TCR repertoire prismbioRxiv - Immunology 2023Quote: ... RNA purification from individual samples (RNeasy Micro Kit, Qiagen), TCR library preparation from cDNA and Library Next Generation Sequencing has been previously described18.
-
bioRxiv - Biochemistry 2024Quote: ... and purified using a QIAquick Gel Extraction Kit (Qiagen). The forward PCR primer (5’-GAAAAACTGGATCGTCTGAAAGCCCGGGCTTAAGGATAAGAACTAACGTGATTCC GGGGATCCGTCGACC-3’ ...
-
bioRxiv - Bioengineering 2024Quote: ... genomic DNA was isolated using a DNeasy kit (QIAGEN). Indels were identified by PCR of the region of interest (Tables S3) ...
-
bioRxiv - Bioengineering 2024Quote: ... homogenization columns and isolation kits were purchased from Qiagen. Bioanalyzer chips and reagents were purchased from Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... vectors were prepared using the EndoFree-Maxi Kit (Qiagen) and resuspended in a sterile 0.9% NaCl solution/plasmid mix containing 10 μg of pT3-MYC (Addgene #92046) ...
-
bioRxiv - Cell Biology 2024Quote: ... utilizing the RNeasy Plus Mini kit (Qiagen, Hilden, Germany). Reverse transcription was carried out using the iScript cDNA Synthesis Kit (BIO-RAD ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA was isolated using QIAamp DNA kit (Qiagen) and used for DNA methylation profiling.
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted using RNeasy micro-kit (Qiagen) following manufacturer’s procedures ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was extracted using the RNeasy Micro kit (Qiagen) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were purified using MiniElute PCR purification kit (Qiagen) and eluted in 10 µl of elution buffer ...
-
bioRxiv - Microbiology 2024Quote: ... total RNA was isolated using RNeasy Mini Kit (QIAGEN) from Pa PAO1 cultures grown until mid-log phase in BMM either supplemented with 5 mM CaCl2 ...
-
bioRxiv - Microbiology 2024Quote: ... we used the DNeasy PowerSoil Pro kit (QIAGEN, 47016) and followed the manufacturer’s standard protocol included in the kit using 100μl of the bacterial culture ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA was extracted using RNeasy Mini Kit (QIAGEN) guided by the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: RNA was extracted with the RNeasy Mini Kit (Qiagen), according to a modified version of the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... was extracted by using RNeasy Plus Mini Kit (Qiagen), and 1 µg total RNA from each sample was reverse-transcribed using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific™ ...