Labshake search
Citations for Qiagen :
5501 - 5550 of 10000+ citations for Rat Hemojuvelin ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen), followed by PCR using the primers ACACGCTTGGGAATGGACAC and CCATGGGAAGATGTTCTGGG and separation on 4% agarose ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated using the RNAeasy Mini Kit (Qiagen), and cDNA was synthesised using SuperScript III (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and DNase treated with the RNase-Free DNase kit (Qiagen) following manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RNA was extracted using RNeasy Micro Kit (Qiagen #74004). RNA concentration was assessed with a Nanodrop spectrophotometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was extracted with the RNeasy mini kit (Qiagen). PolyA-tailed mRNA was selected with beads from 1μg total RNA using the NEBNext Poly(A ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted with the RNeasy Plus kit (QIAGEN) and reverse transcribed using iScriptΪ™ Select cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was isolated using the miRNeasy mini kit (217004, Qiagen [WERFEN ESPAÑA ...
-
bioRxiv - Cancer Biology 2020Quote: ... using miScriptSYBR Green PCR kit (Perfect Real Time) (Qiagen, #218161). Reaction mixtures were incubated for 10 min at 95 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted using the RNeasy Mini kit (QIAGEN) following the protocol for “Purification of Total RNA from Plant Cells and Tissues and Filamentous Fungi” including an on-column DNAse digest ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted from cells with an RNeasy Kit (Qiagen) and was sequenced using Illumina TruSeq strand specific library ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted from cells using the RNeasy kit (Qiagen), and subsequently converted into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermofisher) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cDNA wassynthesized using the miScript II RT kit (Qiagen). Quantitative PCR was performed using the SensiFAST SYBR Hi-ROX kit (Bioline ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: RNA was extracted with the RNA easy mini kit (Qiagen) and proteins were extracted by cell lysis in Laemmli buffer (50 mM Tris-HCl (pH 7.5) ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... mRNA was extracted and purified with RNeasy Mini kits (Qiagen). Total RNA (200 ng ...
-
bioRxiv - Cell Biology 2021Quote: RNA isolation was performed with the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted with RNeasy mini kit (74104, Qiagen), and quantified (Nanodrop 2000) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated using an RNAeasy Mini Kit (Qiagen, Germany) and then converted into cDNA using PrimeScript RT Master Mix (Takara Bio Inc ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted with the RNeasy Mini kit (Qiagen, 74104) according to the manufacturer’s instructions and sample concentrations were determined by NanoDrop ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated using the RNeasy kit (Qiagen 74106) and reverse transcribed into cDNA using the qScript cDNA synthesis kit (Quanta 95048–500) ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was isolated using miRNeasy RNA purification kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... and target amplicons were extracted using DNA extraction kit (Qiagen). 10 ng of purified PCR products were incubated with I-SceI endonuclease (NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA extractions were performed using an RNeasy Micro Kit (Qiagen), followed by cDNA synthesis using the QuantiTect Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2019Quote: ... The AllPrep DNA/RNA kit Micro (#80284, Qiagen, Germantown, MD) was used to extract gDNA from each sample10 ...
-
bioRxiv - Genomics 2020Quote: RNA was extracted using the RNeasy plus kit from QIAGEN. For the cell lines ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... RNA was extracted using a RNeasy Micro plus kit (Qiagen) and quantified using an Agilent 2100 Bioanalyser ...
-
bioRxiv - Physiology 2021Quote: ... DNA was purified using Mini Elute PCR purification kit (Qiagen) and qPCR were performed using promoter-specific primers.
-
Barcoding and demultiplexing Oxford Nanopore native RNA sequencing reads with deep residual learningbioRxiv - Genomics 2019Quote: ... followed by purification using the RNeasy Mini Kit (Qiagen-74104). Correct IVT product lengths for Sequins were confirmed using Bioanalyzer (Figure S3B) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was prepared with RNeasy Plant Mini Kits (QIAGEN) and reverse transcribed with SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was isolated with the RNeasy plant mini kit (QIAGEN – including on-column DNase I treatment ...
-
bioRxiv - Neuroscience 2021Quote: ... tagmented DNA was purified using MinElute PCR purification kit (Qiagen) and size selected for 70 – 500 bp using AmpureXP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2021Quote: ... and seedlings using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) followed by elimination of DNA using on-column DNase (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... isolated with the use of a Plasmid Maxi Kit (Qiagen), and then subjected to in vitro transcription in a transcription mixture of 100 μl containing 10 μg of plasmid as template DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... and RNA extraction was done using RNeasy Micro Kit (Qiagen) as previously described by (25) ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNAs were extracted using the RNeasy Mini Kit (Qiagen). Samples were treated with DNase I (Thermo Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA was purified with Qiagen MinElute PCR purification Kit (Qiagen).
-
bioRxiv - Biochemistry 2021Quote: Total RNA was extracted using the RNeasy Mini Kit (QIAGEN) and RNA-seq libraries were prepared using the TruSeq RNA Sample Preparation Kit v2 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted using RNeasy mini kit (Qiagen, 74104). The RNA was subjected to DNase treatment (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by mtDNA isolation with QIAprep Spin Miniprep Kit (Qiagen). To examine the total uracil content in mtDNA ...
-
bioRxiv - Biochemistry 2020Quote: ... The vector was isolated using Qiagen plasmid maxi kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were purified with the MinElute PCR Purification Kit (Qiagen).
-
bioRxiv - Bioengineering 2021Quote: ... RNA isolation is performed using RNeasy Mini Kit (Qiagen 74104) as per kit instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... and the RNA was extracted with RNeasy mini kit (Qiagen). cDNA was generated from 1500 ng of RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from cells using an RNeasy kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and cell lines using the RNeasy Mini extraction kit (Qiagen). cDNA was prepared from total RNA using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... The RNA was extracted with the RNeasy micro kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total DNA was isolated using DNeasy Blood & Tissue Kit (Qiagen) according to manufacturer’ ss instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA purification was achieved through QIAamp DNA Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was isolated using the RNeasy Mini Kit (QIAGEN, 74106) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted using the RNeasy Mini Kit (Qiagen). RNA was quantified using a Nanodrop (Molecular Devices) ...