Labshake search
Citations for Qiagen :
5501 - 5550 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... followed by clean-up with the RNeasy Mini Kit (Qiagen). Total RNA yield and quality was determined using a NanoDrop ND-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... The RNA was purified using miRNeasy® Mini Kit (Qiagen), and all samples had RIN values >7.5 ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated by using the RNeasy Kit (Qiagen), and cDNA synthesis was performed using SuperScript II Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cDNA produced with the Omniscript RT Kit (Qiagen, #205111) with oligo dT primers ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was isolated with the RNeasy Mini Kit (Qiagen, #74104) and cDNA produced with the Omniscript RT Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated using the RNeasy Mini Kit (Qiagen) from Trp53 KO or Trp53 mutant astrocytes ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA was isolated using the RNeasy Mini Kit (Qiagen). RNA quality was assessed using BioAnalyzer 2100 and/or TapeStation RNA Screen Tape (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... and the RNeasy Plus RNA Extraction Kit (Cat# 74134, Qiagen). cDNA was generated using the TaqMan Reverse Transcriptase Kit according to the manufacturer’s instructions (Cat# N8080234 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was extracted using RNeasy Mini kit (Qiagen, cat# 74104), followed by quality assessment via Agilent 2200 Tape Station ...
-
bioRxiv - Biophysics 2020Quote: ... and DNA was extracted using the Blood Mini Kit (Qiagen). Early (RU5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... samples were subjected to Allprep DNA/RNA Mini Kit (QIAGEN) following the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were purified using QIAquick PCR Purification kit (Qiagen). PCR products were followed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... and root tissues using a Qiaprep Spin Miniprep kit (Qiagen). At 14 d (16 days post-inoculation ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized using the Quantitect Reverse Transcription Kit (Qiagen), followed by PCR using the primers ACACGCTTGGGAATGGACAC and CCATGGGAAGATGTTCTGGG and separation on 4% agarose ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated using the RNAeasy Mini Kit (Qiagen), and cDNA was synthesised using SuperScript III (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... and DNase treated with the RNase-Free DNase kit (Qiagen) following manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RNA was extracted using RNeasy Micro Kit (Qiagen #74004). RNA concentration was assessed with a Nanodrop spectrophotometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was extracted with the RNeasy mini kit (Qiagen). PolyA-tailed mRNA was selected with beads from 1μg total RNA using the NEBNext Poly(A ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted with the RNeasy Plus kit (QIAGEN) and reverse transcribed using iScriptΪ™ Select cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was isolated using the miRNeasy mini kit (217004, Qiagen [WERFEN ESPAÑA ...
-
bioRxiv - Cancer Biology 2020Quote: ... using miScriptSYBR Green PCR kit (Perfect Real Time) (Qiagen, #218161). Reaction mixtures were incubated for 10 min at 95 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted using the RNeasy Mini kit (QIAGEN) following the protocol for “Purification of Total RNA from Plant Cells and Tissues and Filamentous Fungi” including an on-column DNAse digest ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted from cells with an RNeasy Kit (Qiagen) and was sequenced using Illumina TruSeq strand specific library ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA was extracted from cells using the RNeasy kit (Qiagen), and subsequently converted into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermofisher) ...
-
bioRxiv - Cell Biology 2021Quote: RNA isolation was performed with the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted with RNeasy mini kit (74104, Qiagen), and quantified (Nanodrop 2000) ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated using an RNAeasy Mini Kit (Qiagen, Germany) and then converted into cDNA using PrimeScript RT Master Mix (Takara Bio Inc ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted with the RNeasy Mini kit (Qiagen, 74104) according to the manufacturer’s instructions and sample concentrations were determined by NanoDrop ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated using the RNeasy kit (Qiagen 74106) and reverse transcribed into cDNA using the qScript cDNA synthesis kit (Quanta 95048–500) ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA was isolated using miRNeasy RNA purification kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... and target amplicons were extracted using DNA extraction kit (Qiagen). 10 ng of purified PCR products were incubated with I-SceI endonuclease (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA was extracted using the RNeasy plus kit from QIAGEN. For the cell lines ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... RNA was extracted using a RNeasy Micro plus kit (Qiagen) and quantified using an Agilent 2100 Bioanalyser ...
-
bioRxiv - Physiology 2021Quote: ... DNA was purified using Mini Elute PCR purification kit (Qiagen) and qPCR were performed using promoter-specific primers.
-
bioRxiv - Plant Biology 2021Quote: Total RNA was prepared with RNeasy Plant Mini Kits (QIAGEN) and reverse transcribed with SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA was isolated with the RNeasy plant mini kit (QIAGEN – including on-column DNase I treatment ...
-
bioRxiv - Neuroscience 2021Quote: ... tagmented DNA was purified using MinElute PCR purification kit (Qiagen) and size selected for 70 – 500 bp using AmpureXP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2021Quote: ... and seedlings using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) followed by elimination of DNA using on-column DNase (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... isolated with the use of a Plasmid Maxi Kit (Qiagen), and then subjected to in vitro transcription in a transcription mixture of 100 μl containing 10 μg of plasmid as template DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... and RNA extraction was done using RNeasy Micro Kit (Qiagen) as previously described by (25) ...
-
bioRxiv - Plant Biology 2021Quote: ... Total RNAs were extracted using the RNeasy Mini Kit (Qiagen). Samples were treated with DNase I (Thermo Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA was purified with Qiagen MinElute PCR purification Kit (Qiagen).
-
bioRxiv - Biochemistry 2021Quote: Total RNA was extracted using the RNeasy Mini Kit (QIAGEN) and RNA-seq libraries were prepared using the TruSeq RNA Sample Preparation Kit v2 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted using RNeasy mini kit (Qiagen, 74104). The RNA was subjected to DNase treatment (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by mtDNA isolation with QIAprep Spin Miniprep Kit (Qiagen). To examine the total uracil content in mtDNA ...
-
bioRxiv - Biochemistry 2020Quote: ... The vector was isolated using Qiagen plasmid maxi kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were purified with the MinElute PCR Purification Kit (Qiagen).
-
bioRxiv - Bioengineering 2021Quote: ... RNA isolation is performed using RNeasy Mini Kit (Qiagen 74104) as per kit instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... and the RNA was extracted with RNeasy mini kit (Qiagen). cDNA was generated from 1500 ng of RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) ...