Labshake search
Citations for Qiagen :
501 - 550 of 1937 citations for Somatostatin Receptor 1 SSTR1 Mouse Monoclonal biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was extracted from patient tissue samples and flash frozen mouse xenograft tumor samples (n = 4) using the RNeasy kit (Qiagen; #74104) and converted to cDNA using the qScript cDNA Synthesis kit (Quantabio ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA from cultured mouse neuro 2a cells was extracted using AllPrep DNA/RNA/Protein Mini Kit (80004, Qiagen, Hilden, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: Total RNA from cultured cells and mouse Achilles tendons were isolated with TRIzol reagent and RNeasy Mini Spin Column (Qiagen Sciences) and reversely transcribed into cDNAs using a SuperScript IV VILO Master Mix (Life Technologies).22,30 The relative abundances of genes of interest were determined by TaqMan PCR using primers and probes purchased from Applied Biosystems TaqMan Gene Expression Assays ...
-
bioRxiv - Microbiology 2023Quote: ... Gene expression was performed using Real-time PCR for RT2 Profile PCR Array Mouse Cytokine and Chemokines using RT2 SYBR® Green Mastermixes (Qiagen). Using the RT2 qPCR Array Data Analysis spreadsheet ...
-
bioRxiv - Physiology 2024Quote: 50 mg of mouse spleens were homogenized in 500 μl of the same lysis buffer using the TissueLyser LT (Qiagen, #85600) (50 sec for 2 min ...
-
bioRxiv - Cell Biology 2023Quote: ... all samples were diluted to the same RNA concentration and 250 ng of RNA from each sample spiked with 100 ng mouse RNA to control reaction efficiency were reverse transcribed using the miScript II RT kit (Qiagen, 218161) with HiFlex Buffer according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was extracted from the proteinase K-digested tail tips of mouse or peripheral blood mononuclear cell (PBMC) of human donors using DNeasy blood tissue kit (Qiagen, #69506). 25 ng of genomic DNA was subjected to bisulfite conversion using a commercial kit (Zymo Research ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... The aqueous phase was collected and mixed at a 1:1 ratio with 70% ethanol (Qiagen). RNA was isolated from this mixture using the RNeasy MinElute Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Total RNA and miRNA fractions were isolated from the mouse frozen tissue with the miRNeasy Micro Kit protocol (Qiagen, Toronto, ON, Canada). All RNA samples were determined to have 260/280 and 260/230 values ≥1.8 ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted and purified from 20 mg (2 pellets) of stool from each mouse using the QIAamp Fast DNA Stool Mini Kit (Qiagen, Germantown, MD). The concentration of DNA in samples was determined by spectrophotometry ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNAs from mouse tumors were extracted and purified using the RNeasy Mini Kit and RNase-free DNase Set (QIAGEN, Valencia, CA) following the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: DNA was isolated from tail biopsies using the Gentra Puregene Mouse Tail Kit according to the manufacturer’s instructions (Qiagen, Valenica, CA, USA). Genomic DNA was digested with BamHI-HF (New England Biolabs ...
-
bioRxiv - Neuroscience 2019Quote: ... Total RNA and miRNA fractions were isolated from the mouse frozen tissue with the miRNeasy Micro Kit protocol (Qiagen, Toronto, ON, Canada). All RNA samples were determined to have 260/280 and 260/230 values ≥1.8 ...
-
bioRxiv - Microbiology 2021Quote: ... Total genomic DNA was extracted from each ked lysate and blood (camel, mouse, and rabbit) using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... Vγ4+TCRγδ+CD3+CD44+CD27− and Vγ4−TCRγδ+CD3+CD44+CD27− populations from each mouse strain were sorted using a FACSAriaIII: populations into RNA protect (QIAGEN, Hilden, Germany). Total RNA was extracted from the sorted cells according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN) ...
-
bioRxiv - Microbiology 2021Quote: ... for subsequent RNA extraction and analysis using the Qiagen RT2 Profiler Mouse Innate and Adaptive Immune Response PCR Array (Qiagen, Hilden, Germany). The lungs were placed in a tissue cassette ...
-
bioRxiv - Pathology 2022Quote: ... was performed using the Qiagen Mouse Inflammatory Response and Autoimmunity (PAMM-077Z) and Mouse Extracellular Matrix and Adhesion Molecules (PAMM-013Z) RT2 Profiler PCR arrays (Qiagen, Hilden, Germany) to evaluate relative gene/mRNA expression in WT compared to mdx and treated compared to untreated muscles ...
-
MK2 deficiency decreases mortality during the inflammatory phase after myocardial infarction in micebioRxiv - Physiology 2023Quote: ... First strand cDNA was synthesized from 0.5 mg of total RNA using QIAGEN RT2 First Strand Kits and transcripts for mouse cytokines and chemokines were quantified using qPCR microarrays comprising 96-well plates precoated with primers (QIAGEN PAMM-150Z). Each 96-well plate also contained primers for 5 housekeeping genes as well as positive and negative controls ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated from the tail tip of a wild-type C57BL/6J mouse using the DNEasy Blood and Tissue Kit (Qiagen, Hilden, Germany). The genomic C-terminal region of OGT was amplified using the Q5 Hot Start High Fidelity 2x master mix (New England Biolabs) ...
-
bioRxiv - Immunology 2023Quote: Total cellular RNA was extracted from mouse placental tissues or HTR8 cells using a RNeasy Plus Mini Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNAs from mouse tumors were extracted and purified using the RNeasy Mini Kit and RNase-free DNase Set (QIAGEN, Valencia, CA) following the protocol provided by the manufacturer ...
-
bioRxiv - Biochemistry 2023Quote: Mouse liver RNA was extracted from 10 mg (± 2 mg) of preserved tissue using RNEasy kits and QIAshredders (QIAGEN; Germantown, MD, USA). Aliquots of RNA from each sample were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was isolated from blood-free cranial lobes of the right mouse lung using the RNeasy Tissue Mini Kit (Qiagen, Hombrechtikon, Switzerland). Isolated RNA was reverse-transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics ...
-
bioRxiv - Microbiology 2024Quote: ... Parasite genomic DNA was purified from the blood of a transfer mouse using the Qiagen QIAamp DNA Blood Kit (Qiagen, Cat# 51106), and genotyping PCR was performed to assess integration into the target locus ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 μl 10X Buffer (Qiagen). PCR products were digested for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... and samples were diluted 1:1 in 70% ethanol and purified using RNeasy columns and reagents (QIAGEN). RNA concentration was measured using a NanoDrop spectrophotometer ...
-
bioRxiv - Systems Biology 2022Quote: ... 12 μl of 1 M Tris-HCl (pH 6.5) and 1 μl RNAse A (Qiagen cat # 19101) were added to the sample and incubated for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted from the indicated mouse tissues and cultured cells using RNeasy® Lipid Tissue Mini Kit (Qiagen, Valencia, CA, USA). Reverse transcription reactions containing 1 μg of total RNA were performed using PrimeScript™ (Takara ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from donor cecal contents and day 0 conventionalized mouse feces using the Qiagen PowerFecal DNA Kit (Qiagen, Hilden, Germany; 12830) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... eyes were enucleated and retinas were immediately dissected and total RNA was extracted from mouse retinal tissue using Qiagen RNeasy Mini Kit as per manufacturers protocol (Qiagen, Valencia, CA, USA) and reverse-transcribed using iScript cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Physiology 2021Quote: RNA was extracted from mouse islets (∼300 islets per sample, pooled from ∼10 mice of the same genotype) using RNAeasy Micro Kit (Qiagen, Valencia CA, USA) as per manufactures instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: Genomic DNA was extracted and purified from mouse tails by a sodium hydroxide method or by proteinase K digestion followed by high-salt precipitation (Gentra/Qiagen, Valencia, CA, USA). In total ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from the mouse cells/tissues and human cell lines using the RNeasy® Mini Kit (Qiagen Inc., Germantown, MD). For human platelets and MEG-01 cells ...