Labshake search
Citations for Qiagen :
501 - 550 of 1877 citations for Serum amyloid A 2 protein SAA2 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... His-NusA-tail fusion proteins were purified using Ni-NTA resin (Qiagen) using standard approaches and His-TEV protease was added to cleave the His-NusA tag from the tail on column at 4°C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein was purified by affinity chromatography using Ni-NTA agarose (Qiagen) resin followed by his tag cleavage by TEV protease and gel filtration using Superdex 200 Increase 10/300 GL column (G.E ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were purified by glutathione-Sepharose (Cytiva) or Ni-NTA agarose (Qiagen) affinity chromatography ...
-
bioRxiv - Cell Biology 2024Quote: ... The proteins were then purified with Ni-NTA agarose beads (QIAGEN; 30210) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... and immunoblotting using anti-Strep antibodies (Qiagen).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... primary mouse anti-His antibody (QIAGEN, 34660), secondary goat anti-rabbit 800CW antibody (LI-COR ...
-
bioRxiv - Microbiology 2022Quote: ... the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Microbiology 2022Quote: ... Tetra·His antibodies (Qiagen, Hilden, Germany; Cat.# 34670), Anti-Mouse IgG (whole molecule) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 20 µL of pooled oocyte culture media using the miRNeasy Serum/Plasma kit (Qiagen) in a final elution volume of 10 µL ...
-
bioRxiv - Molecular Biology 2020Quote: ... Viral genomic DNA was extracted from whole blood and serum samples using the QIAamp DNA Mini Kit (Qiagen, USA). Genomic DNA of ASFV was identified by a commercial real-time PCR kit (Median Diagnostics Inc. ...
-
bioRxiv - Genomics 2020Quote: ... RNA was isolated within two hours after tear collection with the miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany, 217184), starting from one 2 mL tube containing each 4 Schirmer strips ...
-
bioRxiv - Immunology 2022Quote: Serum viral RNA was extracted from 200 μl using the QiaAmp Min Elute Virus Spin kit (Qiagen, Cat# 57704) according the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Isolation of exosomal RNA from plasma was performed using the Qiagen ExoRNeasy Serum/Plasma Midi kit (QIAGEN, Cat. 77044) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... cfDNA was extracted from 0.5 ml of plasma or serum using the QIAmp DNA Mini Blood kit (Qiagen, CA), according to the ‘‘Blood and body fluid protocol’’ and our own detailed protocol [37] ...
-
bioRxiv - Cell Biology 2023Quote: ... Drosophila S2 cells were cultured in Excel media without fetal bovine serum (FBS) and co-transfected with Effectene (Qiagen). The expression of the copper-inducible transgenes was induced by adding CuSO4 (700 µM ...
-
bioRxiv - Cancer Biology 2023Quote: ... mixed with 100 μl of serum-free medium and 12 μl of HiPerfect Transfection Reagent (Qiagen, Germantown, MD, USA). Effectiveness of ARSB silencing was confirmed by activity assay ...
-
bioRxiv - Microbiology 2024Quote: ... All strains were cultured in biphasic medium (Novy–MacNeal–Nicolle (NNN) + Schneider’s added Fetal Calf Serum 20%) prior to genomic DNA extraction (DNeasy Blood & Tissue Kit, Qiagen). Species were confirmed by multilocus enzyme electrophoresis (MLEE ...
-
bioRxiv - Microbiology 2024Quote: ... bacteria and serum mixtures were transferred into 15 ml centrifuge tubes containing 3 ml of RNAprotect Bacteria Reagent (Qiagen). After vortexing for 5 s at high speed ...
-
bioRxiv - Cancer Biology 2024Quote: ... Circulating exosomes and their miRNA content from plasma samples were obtained with exoRNeasy Serum/Plasma Midi Kit (Qiagen, Germany).
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
Gliflozins, sucrose and flavonoids are allosteric activators of lecithin:cholesterol acyltransferasebioRxiv - Biochemistry 2024Quote: ... LCAT expression in 293T cells was verified by western blot with an anti-His antibody (Qiagen Penta-His Antibody). LCAT was purified by Ni Sepharose excel (Cytiva ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... root or shoot tissues were ground in 2 mL tubes (Qiagen) containing 3 chrome steel beads of 3.2 mm diameter (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 hours and purified using QIAquick PCR Purification Kit (Qiagen). Guide RNA sequence was ordered as oligos (Tm = 51°C ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2× volume of RNAprotect Bacteria Reagent (QIAGEN) for 10 min at room temperature and collected as pellets by centrifugating for 10 min at 5,000×g ...
-
bioRxiv - Genomics 2024Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Genomics 2024Quote: ... 2 ml of RNAprotect® Bacteria Reagent (cat # 76506, Qiagen Inc.) was added ...
-
bioRxiv - Bioengineering 2021Quote: ... The protein was purified using a Ni-NTA Superflow column (Qiagen, Netherlands, 30761) on a Äkta Express fast protein liquid chromatography system (FPLC ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transiently transfected with mammalian protein expressing plasmids using Effectene (Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... His-tagged proteins were purified on Ni-NTA agarose (Qiagen; catalog no. 30761) and GST-tagged TopBP1 protein was purified on Glutathione Sepharose™ 4B (GE healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: DNA was extracted using AllPrep DNA/RNA/Protein Mini Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... and the soluble protein fractions were purified by Ni-NTA resin (Qiagen, # 30230). The purified fraction was concentrated ...
-
bioRxiv - Biochemistry 2020Quote: ... The target proteins were purified with nickel chelate affinity resins (Ni-NTA, Qiagen). The protein samples were collected and purified by a Superdex 200 (GE Healthcare ...