Labshake search
Citations for Qiagen :
501 - 550 of 737 citations for Recombinant Human ABHD15 His tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: FlexiTube siRNA was used to knock-down human PDE2A (Cat#: SI00040159, Qiagen). AllStars Negative CTRL siRNA was used as control (Cat# ...
-
Loss of PKCθ-GADD45a axis drives triple-negative breast cancer cells into p53-independent senescencebioRxiv - Cancer Biology 2024Quote: RT2 Profiler PCR Arrays Human Cellular Senescence (PAHS-050ZD-2) from Qiagen were used to identify the gene expression profiles of MDA-MB-436 cells expressing siCtrl or siPKCθ-1 ...
-
bioRxiv - Microbiology 2020Quote: The RNA genomes of recombinant MeV in P2 or P10 were isolated from infected Vero cells using the QIAamp Viral RNA Mini Kit (QIAgen, Hilden, Germany) according to the manufacturer’s instructions and resuspended in 50 μL RNase-free water ...
-
bioRxiv - Genetics 2021Quote: ... The final constructs were transformed into BL21 (DE3) for expression and recombinant Fur/mFur proteins were purified using Ni-NTA agarose (Qiagen, California, USA). The proteins induced by the addition of 1 mM IPTG at 16°C for 12 h ...
-
bioRxiv - Neuroscience 2021Quote: Cytokine secretion assays were performed using Human Multi-Analyte ELISArray plate (Qiagen CMEH6321A). IL1β ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were prepared using the QIASeq Human Comprehensive Cancer Panel Kit (Qiagen #333515) and sequenced on an Illumina HiSeq 2500 or NovaSeq 6000 ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was extracted from human cells with an RNeasy Mini kit (Qiagen). Northern blot was performed as described previously (Tafforeau et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Human rRNA depletion was performed using the QIASeq FastSelect kit (Qiagen, Hilden, Germany). RNA sequencing library preparation used NEBNext Ultra II RNA Library Prep Kit for Illumina following the manufacturer’s recommendations (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or primary human cells were extracted using the Qiagen RNeasy Micro Kit (Qiagen). cDNA was produced using the SuperScript IV VILO cDNA Synthesis Kit (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... using commercially available primers for human FAAH (CpG Island 100530) (EPHS100530-1A, Qiagen). Methylation-sensitive (EPHS115450-1A ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was extracted from human thyroid tissues using miRNeasy Mini kit (Qiagen) according to the manufacturer’s instructions and as described [26] ...
-
bioRxiv - Immunology 2023Quote: DNA from human stool samples was extracted with DNeasy PowerSoil Pro kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2022Quote: Total RNA for human TSCs was extracted using RNeasy Micro kit (Qiagen, 74004) with on-column DNase digestion ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a 96 well RT2 profiler PCR array human apoptosis kit (Qiagen, Germantown, MD) containing 84 apoptotic genes was used according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Genetics 2021Quote: Human genomic DNA (gDNA) was extracted using the QIAamp DNA Mini Kit (QIAGEN, Germany) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... pallidum and human RNase P gene (RNP) using a Rotor-Gene 6000 instrument (Qiagen) as previously described with modifications (11 ...
-
bioRxiv - Immunology 2021Quote: ... total RNA of CD8+ human T cells was extracted by miRNeasy Mini Kit (Qiagen), following the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and human islets were isolated using RNeasy Mini or Micro kits (Qiagen; Valencia, CA). Reverse transcription was completed with a High Capacity cDNA Reverse Transcription kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... rodent tissues and human samples using the Qiagen Blood and Tissue Kit (Qiagen, USA). The procedures prior to protein digestion were as follows ...
-
bioRxiv - Neuroscience 2022Quote: Cultured human T cells after treatment were flash frozen in Buffer RLT (Qiagen, 79216) and kept in −80°C until processing ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA from cultured human cells were isolated using the QIAamp DNA kit (Qiagen) and genomic DNA from MEFs and mouse tissue samples were extracted using the DNeasy Blood and Tissue Kit (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: cDNA was generated from 5μg of Human XpressRef Universal Total RNA (Qiagen cat # 338112) using Superscript III Reverse Transcriptase (Invitrogen cat # 18080093 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total RNA was extracted from cultured human ECs using a RNeasy Mini kit (Qiagen). For reverse transcription ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or human ABCB1-transfected MDR-19 cells using the RNeasy Mini extraction kit (Qiagen). First strand cDNA synthesis was performed on 500 ng of template RNA using MMLV reverse transcriptase (fc 10 units/µl) ...
-
bioRxiv - Microbiology 2021Quote: The RTK RNAi library contained siRNAs targeting 56 human RTK genes (Qiagen, Dusseldorf, Germany), which included four different pairs of siRNAs for each gene ...
-
bioRxiv - Neuroscience 2023Quote: Transfected iPSC-OPCs and post-mortem human MS samples were lysed in Qiazol (Qiagen), and RNA was isolated using a standard chloroform extraction and ethanol precipitation method ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: Bacterial and human cells were treated with RNAprotect cell or bacterial reagent (Qiagen, Germany) and stored at -80°C for up to 1 week ...
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Physiology 2023Quote: Total RNA was isolated from human islets using the miRNeasy Mini Kit (Qiagen, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... genomic DNA from human primary T cells was isolated using Gentra Puregene Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was isolated from human cells using RNeasy Mini kits (QIAGEN, Hilden, Germany) and reverse transcribed using Super-Script III (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from primary human PTC with the RNeasy Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: A human mitochondrial energy metabolism PCR array (Qiagen RT2 Profiler PCR Arrays, PAHS-008YA) was performed from cDNA synthesized from 1 µg of total RNA from the tumors of control and CPI-613 treated mice ...
-
bioRxiv - Molecular Biology 2024Quote: ... SC-islets or human islets were transferred to buffer RLT (#79216, Qiagen, Hilden, Germany) and stored at -80°C ...
-
bioRxiv - Cancer Biology 2024Quote: siRNAs against human ERBB4 (Hs_ERBB4_5 FlexiTube siRNA, #SI02223893 and Hs_ERBB4_6 FlexiTube siRNA, #SI02223900, Qiagen) or non-targeting control (NTC ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...