Labshake search
Citations for Qiagen :
501 - 550 of 10000+ citations for Oxytocin ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: Cells were lysed directly in the plate using Buffer RLT (Qiagen) with 10uL/mL 2-mercaptoethanol following a quick PBS rinse ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plate was then processed in the PyroMark Q24 pyrosequencer (Qiagen). Results were analyzed with PyroMark Q24 Advanced 3.0.1 software ...
-
bioRxiv - Immunology 2023Quote: ... RT qPCR was conducted with custom array plates (330171, Qiagen, Canada) using the LightCycler 480 Real-Time PCR system (Roche Molecular Systems Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... and a 96-well PowerMag Glass Bead plate (Qiagen, Hilden, Germany). The Glass Bead Sterilizer was turned on ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed with PBS using a 96-well plate manifold base (Qiagen) connected to the vacuum and eluted into 96-well PCR plates using 86 μl of 0.1 M glycine-HCl buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Immunology 2022Quote: ... The middle and inferior right lobes were weighted and homogenized with PBS (1:5 w/v) using a 5 mm stainless steel bead (Qiagen, USA) and a TissueLyser LT (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.1 g of tissue per 1 mL of PBS was homogenized with stainless steel beads of 5 mm (25–30 Hz for 5 min) by a Tissuelyser (Qiagen, Venlo, Netherlands). The homogenates were centrifuged at 10,000 x g for 10 min and the supernatant was collected and stored at −80 °C until CD quantification ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... we added a 5-mm stainless steel bead (QIAGEN) and 100 μl of PBS to each tube and lysed the samples by TissueLyser II (QIAGEN ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg total RNA was treated with DNase (Qiagen) and purified (RNeasy Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... A single sterile 5 mm stainless steel bead (Qiagen) was added to each tube ...
-
bioRxiv - Neuroscience 2022Quote: ... and added 5 volume PB including pH-indicator (Qiagen) and 200 μL sodium-acetate (3M ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 µl Hot Start Polymerase (Qiagen, 5 U/ µl), 20 ng/µl DNA template (95°C for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... siWDR1 (5’-GGTGGGATTTAGGCAATTATT) and AllStars Negative Control siRNA (Qiagen).
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... A 5 ml Strep-tactin Superflow Plus column (Qiagen) was equilibrated with 50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 5 mm diameter stainless steel bead (Qiagen) for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Genomics 2021Quote: ... 5 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a 5 mm stainless steel bead (Qiagen #69989) in an RNase-free microcentrifuge tube ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5 mm stainless steel beads (QIAGEN Cat#69989). To these tubes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 µl SYBR Green Mix (Qiagen N.V., Venlo, Netherlands), and 3 µl nuclease-free water (total volume ...
-
bioRxiv - Physiology 2023Quote: ... and homogenized using 5-mm steel beads (Qiagen #69989) in a bead mill (Qiagen TissueLyser LT) ...
-
bioRxiv - Microbiology 2023Quote: ... 5×105 cells were lysed in RLT buffer (QIAGEN) with 10 μL of β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2020Quote: Cells were harvested from 24-well plates in 350μL RLT Plus (Qiagen) supplemented with 1% beta-mercaptoethanol after an 8-hour induction with 10nM E2 or DMSO ...
-
bioRxiv - Microbiology 2019Quote: ... each plate contained the same amount of the following siRNAs from Qiagen as knockdown controls ...
-
bioRxiv - Plant Biology 2020Quote: ... Initial hits were further optimized in 24-well sitting-drop plates (Qiagen) using as reservoir solution 18-22 % PEG 3350 ...
-
bioRxiv - Genetics 2020Quote: ... the deepwell plates were filled with the following reagents: wash buffer (Qiagen), 80% Ethanol ...
-
bioRxiv - Immunology 2020Quote: ... Plates were spun down and cell pellets were resuspended in Qiazol (Qiagen) for RNA extraction ...
-
bioRxiv - Neuroscience 2023Quote: ... the deepwell plates were filled with the following reagents: wash buffer (Qiagen), 80% Ethanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 96-well plates or a Rotor-Gene Q (Qiagen, Hilden, Germany) in 4-tube strips.
-
bioRxiv - Cancer Biology 2021Quote: ... a 19-mer SPRY2 target sequence (5′-AACACCAATGAGTACACAGAG-3) (QIAGEN) was used and for the control a 19-mer NSi control sequence (QIAGEN ...
-
bioRxiv - Cell Biology 2020Quote: ... For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen) was used as described (Thein et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Wells contained 5 μl/well TCL-buffer (QIAGEN, cat. 1031576) with 1% 2-Mercaptoethanol ...
-
bioRxiv - Microbiology 2019Quote: ... each along with 5 mm diameter stainless steel beads (QIAGEN). The TissueLyser II (QIAGEN ...
-
bioRxiv - Molecular Biology 2019Quote: ... using mechanical disruption with 5 mm stainless steel beads (Qiagen) on a Tissue Lyser II (Qiagen) ...
-
bioRxiv - Plant Biology 2020Quote: ... 0.12 units of Taq DNA polymerase (Qiagen, 5 units/μL) and 14.44 μL of ultra-pure water ...
-
bioRxiv - Microbiology 2021Quote: ... was added to a column (Qiagen, 5 mL polypropylene column), equilibrated with lysis buffer ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... bead mill with 5-mm stainless-steel beads (Qiagen, #69989). Homogenates were centrifuged at 16,000 g for 5 minutes ...
-
bioRxiv - Immunology 2021Quote: ... and 5 mm stainless steel beads (Qiagen, Cat No. 69989) and briefly centrifuged ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... bead mill with 5-mm stainless-steel beads (Qiagen, #69989). Insoluble debris was pelleted by centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... with two 5-minute cycles on a TissueLyser II (Qiagen) separated by a 5-minute incubation on ice ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mL erythrocyte lysis buffer (EL buffer, Qiagen, Hilden, Germany) was added and PMNs were centrifuged ...
-
bioRxiv - Cancer Biology 2024Quote: ... along with a pre-chilled 5-mm steel bead (QIAGEN). All samples were then placed in pre-chilled cassettes for the Tissue Lyser II and pulverized for at 30 1/s for three 1-minute oscillations ...