Labshake search
Citations for Qiagen :
501 - 550 of 10000+ citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and a Rotor Gene Q Real-Time PCR (Qiagen) Machine ...
-
bioRxiv - Neuroscience 2021Quote: ... were performed using the Rotor-Gene Q system (Qiagen) and the QuantiTect SYBR Green PCR Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2021Quote: ... on a Rotor-Gene Q machine (Qiagen, Hilden, Germany). Primers were manufactured by Macrogen (Seoul ...
-
bioRxiv - Molecular Biology 2020Quote: ... was performed using the Rotor-Gene Q thermocyler (QIAGEN).
-
bioRxiv - Biochemistry 2021Quote: ... using the Rotor-Gene Q qPCR cycler from Qiagen and the HRM (High Resolution Melt ...
-
bioRxiv - Microbiology 2022Quote: ... and Rotor-Gene Q real-time PCR cycler (Qiagen).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... in a Rotor-Gene Q thermocycler (Qiagen, Germantown, MD). PCR primers are specific to the VSVG gene (Forward Primer 5’ GCAAGCATTGGGGAGTCAGAC 3’ ...
-
bioRxiv - Immunology 2020Quote: ... Gene expression analysis was performed with assays from Qiagen: glyceraldehyde 3-phosphate dehydrogenase (GAPDH ...
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: ... Acvr1c genes and control (Gl2) were obtained from Qiagen (#SI02735194 ...
-
bioRxiv - Microbiology 2019Quote: ... Rotor-Gene Q Series Software (Qiagen GmbH, Hilden, Germany) was used for the analysis ...
-
bioRxiv - Microbiology 2021Quote: ... and analyzed with the Rotor-Gene 6000 software (Qiagen). A gain optimization was carried out at the beginning of the run ...
-
bioRxiv - Microbiology 2021Quote: ... and analyzed with the Rotor-Gene 6000 software (Qiagen). A gain optimization was carried out at the beginning of the run ...
-
Anatomical meniscus construct with zone specific biochemical composition and structural organizationbioRxiv - Bioengineering 2019Quote: ... was used with Corbett Rotor-Gene 6000 (Qiagen, Germany) system for qPCR analysis ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were run in a Rotor-Gene Q (Qiagen) and analyzed using PCR miner (Zhao and Fernald ...
-
bioRxiv - Microbiology 2023Quote: ... on a Rotor-Gene® Q MDx instrument (Qiagen). The relative expression of the target genes was calculated with the Rotor-Gene Q Series Software using the 2-ΔΔCT method ...
-
bioRxiv - Neuroscience 2023Quote: ... The Rotor-Gene Q real-time PCR cycler (Qiagen) was used to determine the mRNA expression level for the genes of interest ...
-
bioRxiv - Neuroscience 2023Quote: ... It was run on Rotor-Gene Q (Qiagen, Germany). The conditions for amplification were followed ...
-
bioRxiv - Microbiology 2023Quote: ... Gene expression was quantified using QuantiNova SYBR green (Qiagen) following the PCR cycling program as follow ...
-
bioRxiv - Bioengineering 2023Quote: ... on a Rotor-Gene Q thermocycler (Qiagen, Valencia, CA) for 45 cycles Both β-actin and ribosomal protein S13 were included as reference genes to permit gene expression analysis using the 2-ddCt method.
-
bioRxiv - Immunology 2024Quote: ... Gene ontology pathway analysis was performed with IPA (QIAGEN), by including genes with adjusted p-value < 0.05 and absolute Log2 fold change > 1.
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: ... 45 cycles at 95° for 15 sec and 60° for 1 min were performed in the Rotor-Gene Q real-time PCR cycler (Qiagen). The numbers of copies of the RdRP gene in the samples were calculated using an RdRP cDNA standard curve.
-
bioRxiv - Cell Biology 2020Quote: 6xHis-tagged GFP-Fis and GFP-NusA were expressed from pCA24N and purified using Ni-NTA resin (Qiagen) in a gravity-flow column at 4°C as described (Kitagawa 2005) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genes with a p-value < 0.05 were determined to be differentially expressed (Fold change >1.5) and the Ingenuity Pathway Analysis (Qiagen) was used for pathway and transcription factor analysis.
-
bioRxiv - Genetics 2021Quote: ... Total RNA was extracted from mouse liver samples using RNeasy Mini Kit (Qiagen), DNase treated and 1 μg total RNA was processed for mRNA sequencing ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA of mouse islets was extracted using RNeasy Plus Mini Kit (Qiagen). Other tissues including mouse liver ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from mouse right adrenals using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from mouse right adrenals using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the RNA from mouse liver was isolated using RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: Total RNA was extracted from mouse pituitaries using an RNeasy mini kit (Qiagen) and 250 ng converted to cDNA using Revertra Ace (TOYOBO ...
-
bioRxiv - Neuroscience 2020Quote: ... or RNeasy Mini Kit (synaptosome and cytosolic fraction from homogenized mouse forebrain; Qiagen). For RT-PCR ...
-
bioRxiv - Immunology 2020Quote: RNA from mouse plasma was isolated using Qiamp RNA-mini isolation kit (Qiagen) and RNA from tissues isolated using the RNeasy mini isolation kit (Qiagen) ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was isolated from mouse B cells using the DNeasy kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted from mouse neural retina using RNeasy mini kit (QIAGEN). Total RNA was reverse transcribed in the presence of PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time ...
-
bioRxiv - Physiology 2023Quote: ... total RNA was prepared from mouse liver using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2023Quote: We extracted RNA from fresh mouse using an AllPrep DNA/RNA kit (Qiagen). We placed 5-10 mg of tissue into 350 μL RLT Plus Buffer in a 2 mL tube containing a 5mm stainless steel bead and homogenized with a TissueLyzer for two 2 min rounds at 30 Hz ...
-
bioRxiv - Immunology 2023Quote: ... Total mRNA was extracted from mouse tumors using the RNeasy Mini Kit (QIAGEN) and subsequently tested for concentration and integrity via NanoDrop 2000c (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... total mRNA was isolated from mouse T cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... the membrane was incubated with mouse primary antibody α-His (1:5000, Monoclonal mouse Tetra-His antibody, Qiagen, #34670) in 2.5% BSA in PBS-T overnight at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen, NSW, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... The gDNA was further analyzed by qPCR targeting the barcode and the endogenous gene BMP2 using the QuantiNova SYBR Green PCR kit (Qiagen, no. 208057-500T) so that the viral titration could be determined.
-
bioRxiv - Genetics 2022Quote: ... the PCR fragment and the plasmid fragment without PDS gene were isolated from agarose gel using QIAquick Gel Extraction Kit (Qiagen, catalog number 28706). The digested PCR products and the pBSMVγ plasmid were ligated using T4 ligase (New England BioLabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resultant backbone without the Puromycin gene was purified using the QIAquick PCR & Gel Cleanup Kit (Qiagen 28506. A DNA block (Table 3) containing the Blasticidin resistance gene sequence was synthetised (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... coli BL21 (DE3) and expression of the His-tagged Cas proteins was performed following the instruction of the protein purification kit (Qiagen, Valencia, CA, USA). Single colonies of transformed cells were cultivated overnight ...
-
bioRxiv - Physiology 2021Quote: ... Total RNA was extracted from EVs (20 μg protein) using miRNeasy Mini Kit (Qiagen). RNA was then reverse-transcribed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: Total cellular RNA was extracted using AllPrep DNA/RNA/Protein mini kit (Qiagen, UK). Reverse transcription was carried out using kits from Invitrogen following the manufacturer’s instructions (SuperScript First-Strand Synthesis System for RT-PCR) ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was then isolated with Qiagen AllPrep DNA/RNA/Protein Mini Kit (Qiagen # 80004). Breast microstructures from 5 independent donors were exposed to vehicle (PBS and PBS plus DMSO) ...
-
bioRxiv - Microbiology 2023Quote: ... Bacteria isolates then underwent DNA isolation using AllPrep Bacterial DNA/RNA/Protein Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Human macrophages were lysed in 350 μL RLT buffer with β-mercaptoethanol and centrifuged through a QIAshredder spin column (Qiagen). cDNA was synthesized from isolated RNA using SuperScript II Reverse Transcriptase (Invitrogen ...