Labshake search
Citations for Qiagen :
501 - 550 of 742 citations for I 309 CCL1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Lentivirus carrying the response elements for type I (ISRE - #CLS-008L-1) or type II (GAS - #CLS-009L-1) upstream of firefly luciferase was purchased from Qiagen. Twenty-four hours post plating ...
-
bioRxiv - Physiology 2019Quote: ... purified RNA was digested on-column with DNase I and cleaned using the Qiagen RNeasy kit (Qiagen, Valencia, CA, USA) as recommended by the manufacturer ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... for 30 seconds at maximum speed to then follow the RNAeasy Mini Kit protocol including a DNase I treatment (Qiagen). The resulting RNA was tested for quality on an Agilent Bioanalyzer and all samples met quality standard of RNA Integrity Number (RIN ...
-
bioRxiv - Plant Biology 2021Quote: ... tissues were ground in liquid nitrogen using a mortar and pestle and RNA were extracted and subsequently treated with DNAse I using the Plant RNeasy Mini extraction kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was extracted from homogenized samples using a Qiagen RNeasy plant RNA extraction kit with on-column DNase I (Qiagen) digestion following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... The transcribed RNA was treated with Turbo DNase I and antarctic phosphatase to remove template DNA and purified by RNeasy MinElute Cleanup Kit (QIAGEN). The concentration was determined by Quibit microRNA Assay Kit ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was removed by passing the lysate through the gDNA eliminator column and by an additional on-column DNase I treatment (Qiagen) before the elution ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA sample was treated with DNase I to remove genomic DNA and retro transcribed into cDNA using Quantitect Reverse Transcription Kit (Qiagen).
-
bioRxiv - Immunology 2021Quote: ... cDNA was quantified using 96-well PCR array analysis on a PAMM-150ZA plate (Cytokines & Chemokines) and PAMM-016ZA plate (Type I Interferon Response) (both Qiagen). Quantitative real time-PCR (QRT-PCR ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA was extracted from each placenta using the Qiagen RNeasy Midi kit and DNase treated with DNase I (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... RNA was collected using Qiagen RNeasy Mini Kits with Qiashredder and on-column DNase I digestions with Qiagen RNase-free DNase Set (Qiagen).
-
bioRxiv - Developmental Biology 2021Quote: ... The aqueous phase was collected and the remainder of the RNA extraction procedure was performed using an RNeasy Mini Kit with on-column DNase I treatment (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: ... for various immune genes were used to amplify cDNA collected from lungs using QuantiNova reverse transcription and SYBR Green I PCR kits (Qiagen). The ΔΔCq method was used with normalization within sample on GAPDH (ΔCq ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR fragment was then digested with Dpn I at 37 °C for 1 h and purified using the QIAquick PCR purification kit (Qiagen). To prepare the competent SW102 containing the pSMART BAC-T7-scv2-replicon ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA was prepared by phenol/chloroform preparations followed by ethanol precipitation and subsequent treatment with RNase-free DNase I (Qiagen). Photometric analyses of RNA samples all had A260/280 ratios higher than 2.1 ...
-
bioRxiv - Microbiology 2021Quote: ... virion RNA was purified using the RNeasy Mini Kit with on-column DNase digestion with RNase-Free DNase I (Qiagen). The copies/μL in the virion standard were estimated by triplicate measurements using the Abbott RealTime SARS-CoV-2 assay (Abbott m2000 Molecular Platform) ...
-
bioRxiv - Neuroscience 2022Quote: The isolation of total mRNA was performed with the RNeasy Micro Kit and treated with Rnase free Dnase I (Qiagen). 500ng were used to synthesize cDNA with the SuperScript III Reverse Transcriptase Synthesis Kit (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... was used for total RNA extraction according to the manufacturer’s protocol which included a first DNase treatment using the On-column DNase I digestion kit (Qiagen, Switzerland). Extracted total RNA was subjected to a second DNase treatment using Promega RQ1 at 1 unit/μg of RNA ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by three rounds of washes with sterile PBS + PI for 45 mins, then subjected to one round of incubation with DNase I (4716728001, MilliporeSigma) + RNase A (19101, Qiagen) + PI for 72 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was digested on-column for 15 min at room temperature using the RNase-free DNase I Set (Qiagen). First-strand complementary DNA (cDNA ...
-
Accumulation of TCR signaling from self-antigens in naive CD8 T cells mitigates early responsivenessbioRxiv - Immunology 2023Quote: 1 × 105 CD8+ CD44LO CD62LHI Qa2HI OT-I GFPLO and GFPHI cells from three biological replicates were sorted into RLT Lysis Buffer (Qiagen) containing 1% 2-mercaptoethanol ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA from mouse embryos were isolated using RNeasy plus micro kit with on-column DNase I digestion method (QIAGEN). cDNA libraries were produced by using an Ovation RNAseq amplification kit Ver ...
-
bioRxiv - Cell Biology 2023Quote: ... BioConcept) in TAE buffer (3-07F03-I, BioConcept) and products were extracted using the QIAquick Gel Extraction Kit (28706, Qiagen) and Sanger sequenced by Microsynth (Balgach ...
-
bioRxiv - Pathology 2023Quote: ... After DNase I digestion and removing the ribosomal RNAs (rRNAs) from total RNA using the QIAseq FastSelect-rRNA Plant Kit probe (QIAGEN), several Adenine bases were tailed at the 3’ end of the remaining RNAs according to Liefting et al (47) ...
-
bioRxiv - Physiology 2024Quote: ... The resulting cRNA probe was digested with DNase I and purified with the RNeasy MinElute cleanup kit (Qiagen, Hilden, Germany).
-
bioRxiv - Plant Biology 2023Quote: ... patens RNA was extracted and rid of contaminant genomic DNA using RNeasy Plant Mini Kit and on-column DNAse I treatment (Qiagen), following supplier’s indications ...
-
bioRxiv - Cancer Biology 2023Quote: ... NHEJ reporter plasmid was digested with I-Sce1 for 6h and purified using a QIAEX II Gel Extraction Kit (QIAGEN). Exponentially growing cells were transfected using an Amaxa nucleofector with the U-023 program ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Physiology 2021Quote: Total RNAs were obtained from human UREC or mouse kidneys using RNeasy Mini Kit (Qiagen) and reverse transcribed using SuperScript II Reverse Transcriptase (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from human organoids using RNeasy Mini Kit with DNase treatment (QIAGEN), and synthesis of cDNA was conducted with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from human or murine cells using the RNeasy Mini Kit (Qiagen), and cDNA synthesized from 1 µg total RNA (High Capacity cDNA Reverse Transcription Kit ...
-
bioRxiv - Immunology 2020Quote: ... total mRNA was isolated from mouse and human B cells by RNeasy Micro kit (Qiagen), reverse transcribed from mRNA to cDNA for subsequent real-time PCR analysis ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Physiology 2020Quote: ... RNA from human islets (∼150 for each donor) was extracted with RNeasy Mini Kit (Qiagen) and was reverse transcribed using the High Capacity Reverse Transcription Kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen) or TRIzol reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... For the RT² Profiler™ PCR Array Human Epithelial to Mesenchymal Transition kit (EMT) (Qiagen), RNA integrity of all the samples was tested by using the Agilent RNA 6000 Nano kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA was extracted from sorted infected primary human hepatocytes using miRNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: RNA was extracted from human primary cells using AllPrep RNA/RNA/miRNA universal kit (Qiagen) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from pigskin and human skin swabs using a DNeasy PowerSoil kit (Qiagen). Procedural extraction control blanks (swabs with sterile water ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from sampled human brains using miRNeasy Mini Kit (Qiagen, CA, USA). The tissue samples were homogenized in QIAzol (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... and human islets was isolated using RNeasy Mini or Micro kits (Qiagen, Valencia, CA, USA). Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.