Labshake search
Citations for Qiagen :
501 - 550 of 10000+ citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were isolated from 5 mL of overnight liquid culture using QIAprep Spin Miniprep Kit (Qiagen, Germany) and the presence of mutations was confirmed by Sanger Sequencing.
-
bioRxiv - Cell Biology 2021Quote: Total RNA from 5×105 FACS sorted p7 MPs was isolated using the RNeasy Micro Kit (Qiagen). RNA quantity and quality was tested on a Qubit®Fluorometer (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng of each RNA was reverse transcribed to cDNA using the miRCURY reverse transcription kit (Qiagen). Qiagen’s miRCURY Locked Nucleic Acid (LNA ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from approximately 5×105 CD133 purified progenitors using an RNeasy micro kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 and 0.22 μm pore-size filters were processed using the DNeasy PowerWater Kit (QIAGEN, Hilden, Germany) following the manufacture instructions ...
-
bioRxiv - Plant Biology 2019Quote: RNA was extracted from leaves of 5-week-old Arabidopsis plants using RNeasy Mini extraction kit (Qiagen) and treated with Turbo DNA-free kit (Ambion ...
-
bioRxiv - Genomics 2021Quote: DNA was extracted from the donors’ peripheral blood (5 ml) using DNeasy Blood & Tissue Kit from QIAGEN according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Ligation of 1 µl 5′RACE PCR products were performed with the Qiagen PCR cloning kit (Qiagen) according to the manufacters protocol ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from neuron-astrocyte co-cultures at 5 weeks using RNeasy Mini kit (74104, Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: On day 5 of dietary exposure RNA was extracted via the Qiagen RNeasy Mini Kit (Qiagen 74104). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... and oligo 5 (Q4) 5’-CACCGAGCTCTTCGCCGAGTA-3’ (Qiagen, SI03058272).
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 5× One-step RT-PCR buffer (QIAGEN), 10 μL Triton-x100 (0.3% ...
-
bioRxiv - Microbiology 2019Quote: ... both hNS1 and hNP cells were transfected with human miRNA-mimics (double stranded RNAs that mimic mature endogenous miRNAs, Procured from Qiagen) of the mentioned ...
-
bioRxiv - Microbiology 2022Quote: ... Gene expression of 84 heat shock genes in mock-infected or 229E-infected cells was analyzed using Human Heat Shock Proteins & Chaperones RT2 Profiler PCR array (Qiagen). Real-time PCR analyses were performed with specific primers ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... we extracted whole blood DNA from all individuals included in the RNA sequencing data using Gentra® Puregene® for human whole blood kit (QIAGEN) and MagAttract® HMW DNA kit (QIAGEN ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out by using the ‘Human Innate and Adaptive immune Response’ kit (Qiagen, Hilden, Germany) to assess the expression of genes/mRNA ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from 1 mL of each human plasma sample using the DNeasy Blood and Tissue kit (Qiagen, 69504, Hilden, Germany) according to the manufacturer protocol and recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 ng of RNA from microdissected human pancreatic islets and from EndoC-βH1 was used to generate cDNA libraries using QiaSeq miRNA library kit (Qiagen, Hilden, Germany) following manufacturer’s instructions (see ESM Methods).
-
bioRxiv - Immunology 2021Quote: Total cell RNA was extracted using the miRNeasy Tissue/Cells Advanced Mini Kit (Qiagen, #217604). Purified RNA yields and quality were assessed via Agilent 2100 Bioanalyzer using the Agilent 6000 RNA Pico chips (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total DNA was amplified from single cells with the REPLI-g Single Cell Kit (Qiagen) and genotyping was performed with NovaTaq Hot Start Master Mix (Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: DNA was isolated from transduced K562 cells using Gentra Puregene Cell Kit (Qiagen, Hilden, Germany), according to the protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... was isolated from cells and cell-derived EVs using the miRNeasy kit (QIAGEN, Germantown MD). The RNA was eluted with 50 μl of nuclease-free H20 ...
-
bioRxiv - Cancer Biology 2023Quote: The genomic DNA of harvested cells were isolated using Blood & Cell Culture Maxi kit (Qiagen). The PCR amplicon spanning the two sgRNAs were generated with PCR using Q5 High Fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Bioengineering 2019Quote: RNA was extracted from cells using the RNeasy Mini Kit or RNeasy plus Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from cells harvested by trypsin with RNA extraction kit (Qiagen, RNeasy Mini Kit), and each group was done in duplicates ...
-
bioRxiv - Genomics 2023Quote: ... The DNA was further purified using the Blood & Cell Culture DNA Midi Kit (Qiagen kit #13343) following the manufacturer’s protocol after one hour of protease digestion ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated from single cell suspensions using a commercial kit (Qiagen RNeasy Mini Kit, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated from single cell suspensions using a commercial kit (Qiagen RNeasy Mini Kit, Qiagen) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Microbiology 2022Quote: ... LF/LF = 5 mice from two cages over two experiments) using the DNeasy PowerSoil Kit (Qiagen, Germantown, MD). Modifications to the standard protocol included a 10-minute incubation at 65°C immediately following the addition of the lysis buffer and the use of a bead mill homogenizer at 4.5 m/s for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-Seq libraries were prepared from 5 ng total RNA using the NEB Next RNA Ultra Kit (QIAGEN) with poly(A ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA from approximately 25 EBs at day 5 of differentiation was isolated using RNeasy Mini kit (Qiagen) and quantified by NanoDrop (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA for expression analyses was extracted from 5 day-old protonemata using a RNeasy Plant Mini Kit (Qiagen). Genomic DNA removal and cDNA synthesis were performed with a Quantitect Reverse Transcription kit (Qiagen).
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from the Sterivex filters (i.e., 0.22–5 μm size fraction) using an AllPrep DNA/RNA Mini Kit (80204; Qiagen) with a modified protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from 5-10 snap-frozen larvae with the RNeasy Mini kit (Qiagen cat no. 74104) and reverse-transcribed using QuantiTect Reverse Transcription kit (Qiagen cat no 205311 ...
-
bioRxiv - Immunology 2022Quote: Total RNA from ~ 5 × 105 neutrophils (CD45+Lin-CD11b+Ly6G+) was isolated with the RNeasy micro kit (Qiagen) and RNA quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Immunology 2021Quote: ... and Trp53.3 CT26Cas9GFP cells using a DNA extraction kit (Qiagen) per the manufacturer’s direction ...