Labshake search
Citations for Qiagen :
501 - 550 of 4315 citations for 7H 1 2 3 Triazolo 4 5 d pyrimidin 7 one 3 6 dihydro since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... We extracted total RNA from 10 leaves that were shorter than 500 µm and from 4–6 mature leaves using the RNeasy Micro Kit (Qiagen) and the RNeasy Plant Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 250 to 1000 μm lengths of epithelium sections were microdissected from 4 to 6 successive serial sections and DNA extracted using a QIAMP DNA microkit (Qiagen) by digesting overnight and following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... diluted in fresh culture media or left untreated (n = 4) for 6 h prior to harvesting RNA in RLT buffer (Qiagen) with added β-ME ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
bioRxiv - Microbiology 2021Quote: A total of 2 x 105 Vero E6 or HEK293ACE-2 cells were seeded 24 hours before transfection with one of the following siRNAs pools (Qiagen SMARTpool): siSTT3A (#GS3703) ...
-
bioRxiv - Microbiology 2021Quote: ... Using the CLC genomics workbench 7 (Qiagen), reads were mapped to the S ...
-
bioRxiv - Microbiology 2023Quote: ... CLC Genomics Workbench version 7 (Qiagen, Germany) was used for analysis of the sequences ...
-
bioRxiv - Immunology 2019Quote: ... approximately 25 mg of tissues were homogenized in 2 mL tubes containing 600 μL of Buffer RLT with 2% β-mercaptoethanol and a stainless steel bead (5 mm, Qiagen) using a TissueLyser II system (Qiagen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA from 3×107 sorted GFP+ cells was extracted using the Blood & Cell Culture DNA Maxi Kit (Qiagen). Amplification of sgRNA regions from the extracted genome and the original sgRNA plasmid library ...
-
bioRxiv - Molecular Biology 2020Quote: ... while method-3 was a modified protocol of the DNeasy PowerMax Soil Kit (Cat.No. 12988-10) provided by Qiagen (based on communication exchanged with the manufacturer) ...
-
bioRxiv - Cell Biology 2019Quote: Transduced GFP+ LT-HSCs from 3 independent biological replicates were sorted directly into 350 ul of RLT buffer (Qiagen). Total RNA was isolated from cells using the RNeasy Micro kit (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was purified from cell passage number 3 using the RNeasy RNA purification kit (Qiagen Cat. No. 75142). A260:280 ratio > 2 and RIN > 9.
-
bioRxiv - Immunology 2021Quote: Bacterial plasmid DNA was extracted from a 3 ml overnight culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Next ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tissue samples were homogenized in 3 mL sterile PBS for 20 seconds on ice using a TissueRuptor homogenizer (Qiagen) with sterile tips ...
-
bioRxiv - Genomics 2022Quote: ... 50 ng of total RNA was processed up to 3’ adapter ligation step according to the manufacturer’s instruction (Qiagen). The adapter-ligated RNA was treated with 5U of RppH (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted at 3 hpi and 24 hpi with the RNeasy Mini Total RNA extraction kit (Qiagen). SARS-CoV-2 RNA was detected with the CDC assay kit (IDT ...
-
bioRxiv - Bioengineering 2022Quote: ... transfected cells were harvested on Day 3 and genomic DNA was extracted using DNeasy Blood & Tissue Kit (QIAGEN # 69506). The region surrounding EMX1 target site was amplified with EMX1-F ...
-
bioRxiv - Immunology 2019Quote: ... Input material (total cytoplasmic mRNA) and efficiently translated mRNA (heavy polysome-associated, >3 ribosomes) were extracted with QIAzol (Qiagen) and purified using RNeasy MinElute Cleanup Kit (Qiagen) ...
-
bioRxiv - Genetics 2020Quote: ... Seedlings of 3-week-old plants were used to extract total RNAs using the RNeasy Plant Mini Kit (Qiagen). Total RNAs were treated with amplification-grade RNase-free DNase I (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Individual tumors were collected in low binding DNA tubes and digested in 3 μl RLT buffer (Qiagen Cat# 1048449) for 30min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Sample tubes were transferred back to ice before 3 rounds of 60 second bead beating on the TissueLyser2 (Qiagen). Samples were incubated at room temperature for five minutes before 200 µL of chloroform (Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were harvested 3 days later by direct application of buffer RLT from the RNeasy mini kit (Qiagen 74104).
-
bioRxiv - Microbiology 2022Quote: ... homogenized in 500 μl PBS by bead beating (3 mm steel ball, 25 Hz for 2.5 min in a TissueLyser (Qiagen)) ...
-
bioRxiv - Plant Biology 2022Quote: 3 μg total RNA was extracted from each flower bud sample using Tiangen Polysaccharide and Polyphenol Kit (QIAGEN, Germany). After passing the quality inspection ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted from 50-80 mg of surface-sterilised (70% EtOH, 0.1% Triton X-100) and 3-days germinated seeds with RNeasy Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 100 mg of seedlings at 3 dpg by means of the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... The samples were loaded on a EconoSpin column and the RNA was washed 3 times with RPE buffer (QIAGEN). The RNA was eluted with distilled nuclease free water ...
-
bioRxiv - Biochemistry 2023Quote: ... the lysate was centrifuged at 15,000 x g for 35 mins and the soluble fraction incubated with 3 mL of Ni-NTA beads (Qiagen) for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... oxydans wild-type cultures at OD600 0.3 units (Exp) or 3 units (Sta) using the RNeasy Mini Kit (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The excess dsDNA was removed by 3 rounds of PCR clean up with QIAquick PCR Purification Kit (Qiagen, 28106).
-
bioRxiv - Cancer Biology 2023Quote: ... The genomic DNA (gDNA) from 3 whole-brain sections per group was isolated by QiaAmp DNA microkit (Qiagen 1048145) and the concentrations were measured by Qubit DNA HS kit ...
-
bioRxiv - Bioengineering 2024Quote: ... spun down for 15 s at 8,000 g and eluted 3 times by adding 700 µL Buffer RW1 (Qiagen) and spinning ...
-
bioRxiv - Microbiology 2023Quote: ... 5.0 x105 293T cells were co-transfected with HIV-1 Env-expressing and HIV-1 Tat-expressing plasmids at a ratio of 1:6 using Effectene (Qiagen) and incubated for 48 hours ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Samples were diluted at 4:1 (elution buffer (Qiagen)/cDNA ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... Subsequent one-step RT-PCR (Qiagen) was performed using gene-specific primers listed in Supplementary Table S2.
-
bioRxiv - Genomics 2021Quote: ... the detection of N-gene of SARS-CoV-2 was performed by using the 2019-nCoV-2 RUO kit (Integrated DNA Technologies, Inc., Coralville, Iowa, USA) and One-Step RT-PCR Kit (QIAGEN® GmbH) on a Rotor-Gene Q real-time PCR cycler (QIAGEN® GmbH) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from MCF10AER/vSrc cells (Control and treated with 10 nM D-Alanine for 4 h or 24 h) using RNeasy Kit (Qiagen, #74104) according to the manufacturer’s instructions ...