Labshake search
Citations for Qiagen :
501 - 550 of 641 citations for 7 ACETOXY 4 BROMOMETHYLCOUMARIN since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and the chromatin incubated at 67 °C for 4 h following a purification step with the QIAquick PCR Purification kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The remaining cells were pelleted at 1000 x g for 10 minutes at 4°C and lysed in 350 µL of Buffer RLT (Qiagen) supplemented with 3.5 µL of 2-β mercaptoethanol (#444203 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Biophysics 2023Quote: ... beads were discarded and the supernatant containing reconstituted into ND A2AAR was incubated for 4 h with 250 µL of Ni-NTA resin (Qiagen) for separating from empty ND ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was isolated from fecal matter and gastrointestinal sections using the DNeasy HTP 96 PowerSoil Kit (Qiagen, 12955-4). All DNA was recovered in ultrapure water without additives and stored at −20 °C.
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1.5 h in 50 mL conical tubes ...
-
bioRxiv - Biochemistry 2023Quote: ... Filters were incubated at 55°C for approximately 4 h and the resulting lysates were purified with the DNeasy kit (Qiagen) using a slightly modified protocol49 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Developmental Biology 2023Quote: ... Supernatants were separated from lysates and incubated with affinity beads at 4°C overnight (His beads: Ni-NTA from QIAGEN; GST beads ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from the hippocampus of P65 females of all four groups (n=4/group) using the RNeasy Midi Kit (Qiagen). RNA samples were submitted to the University of Minnesota Genomics Center for library preparation and sequencing ...
-
bioRxiv - Bioengineering 2023Quote: Genome DNA was extracted from each cell line every 3 – 4 days after transfection or transduction using DNeasy Blood and Tissue Kit (QIAGEN) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen). 4-week-old NRG mice were injected intra-hepatically using 10 µg of RNA in a maximum volume of 50 µL of PBS+RNA and one week post injection a terminal bleed was performed ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1 h in 50 mL conical tubes ...
-
bioRxiv - Pathology 2023Quote: ... tissue and cells were lysed in RIPA lysis buffer supplemented with orthovanadate and a cocktail of protease inhibitors at 4°C (using a TissueLyser (Qiagen) to homogenize liver tissue ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from ten 4-mL aliquots of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104).
-
bioRxiv - Molecular Biology 2024Quote: ... and the supernatant was added to a 500 μl equilibrated Glutathione Sepharose 4 Fast Flow affinity medium (GE) or Ni-NTA agarose (Qiagen). The lysate was incubated with an affinity matrix for 1 hour at 4 ⁰C ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates were centrifuged for 30 min at 38,000 g and 4°C and cleared supernatants loaded onto Ni-NTA columns with 0.5 mL bed volume (1018244 Qiagen, Germany). The columns were washed sequentially with 3 column volumes (CV ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting samples were supplemented with 300 mM NaCl and 10 mM imidazole and incubated overnight at 4 °C on a stirring wheel with 50 µl Ni-NTA agarose resin slurry (QIAGEN) pre-equilibrated with wash buffer I (50 mM Tris-HCl pH 7.8 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were selected in puromycin (1 μg/ml) the next day and after 4 days genomic DNA was extracted using DNeasy Blood and Tissue kit (Qiagen). Genomic DNA was sonicated to an average size of 500 bp using S2 Focused-ultrasonicator (Covaris ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplicons were size-verified on a 4% agarose gel and PCR amplicons were extracted and purified (Qiaquick Gel Extraction Kit, Qiagen) before indexing (Nextera XT ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then samples and inputs were incubated for 4 hr at 37°C with 1.5 µl of 10 mg/ml RNase A (Qiagen, 1007885) and 15 µl 10% sodium dodecyl sulfate and 3.5 µl 20 mg/ml Proteinase K (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: ... Digested product was then run on a 4% agarose gel with 1x SYBR Safe for 45 minutes at 100 V and gel extracted (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... Sample DNA was extracted from microbiome samples using the PowerSoil DNA extraction kit (Cat. No. 12955-4, Qiagen, Valencia, California). Marker genes in isolated DNA were polymerase chain reaction (PCR)-amplified using GoTaq Master Mix (Cat ...
-
bioRxiv - Biochemistry 2023Quote: A kinome-wide siRNA library that contained 4 individually arrayed siRNA sequences in 384-well plates was purchased from Qiagen. The library consisted of known kinases and associated proteins ...
-
bioRxiv - Immunology 2024Quote: ... Cytosolic fractions were prepared by centrifugation at 10,000 × g for 30 min at 4°C and DNA was isolated from them using the DNeasy Blood & Tissue kit (Qiagen). The copy number of mitochondrial DNA encoding 16S RNA (RNR2 ...
-
bioRxiv - Pathology 2024Quote: ... by running one homogenization cycle (50 Hz oscillation frequency (50 cycles/s) for 4 minutes) in a Tissue lyser LT (Qiagen). Tubes were then centrifuged at 5000 rpm for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... Total RNA was extracted from the supernatant (12,000 x g for 10 min at 4°C) of centrifuged tissue homogenate using an RNeasy Mini Kit (Qiagen, USA). The extracted total RNA was used for single-strand cDNA synthesis ...
-
bioRxiv - Genomics 2024Quote: ... Fosmid clones from the WIBR-1 library were purchased from the BACPAC Resources Center (for coordinates and names, see Supplementary Table 4) and isolated using Large-Construct Kit (Qiagen).
-
bioRxiv - Biochemistry 2024Quote: ... Lysed cells were sedimented by centrifugation at 20,000 RCF at 4 °C for 30 min and the lysate was subsequently loaded onto pre-equilibrated Ni-NTA agarose resin (Qiagen) at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell pellet was removed after centrifugation (16000 rpm, 4 °C, 1 h) and supernatant was loaded into a Ni-NTA agarose column (Qiagen). Protein was eluted in an elution buffer (50 mM Tris-HCl ...
-
bioRxiv - Genetics 2024Quote: ... PCR was performed with 2 µL (∼16 ng) or 4 µL (∼32 ng) of BT-converted DNA with HotStar Taq Polymerase (Qiagen), depending on the genomic region ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Microbiology 2024Quote: ... Lysates were centrifuged for 30 min at 30000 x g in 4 °C and the resulting supernatants were gently mixed with Ni-NTA Agarose beads (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... Luciferase reporter constructs were either mock-treated or methylated in vitro with SssI CpG methyltransferase for 4 h at 37 °C and purified with the QIAquick Purification Kit (QIAGEN 28704). Reporter plasmid (500 ng ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng of plasmid DNA was transfected into each well using Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427). Unless otherwise noted ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bacterial cells were pelleted by centrifugation at 6,000 RCF at 4°C for 15 minutes and plasmid DNA was extracted using a Qiagen Plasmid Plus Midi Kit (Qiagen #12943). To estimate the total number of unique barcodes present in the plasmid pool ...
-
bioRxiv - Physiology 2020Quote: ... RNA was isolated from maternal and fetal tissues (Table 3 and 4) using QIAamp cador pathogen mini kit (Qiagen, Valencia, CA). ZIKV RNA was quantitated by one-step quantitative real time reverse transcription PCR using QuantiTect probe RT-PCR kit (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... The fresh blood sample was immediately brought to the laboratory at 4 °C and genomic DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, USA) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Negative controls included 4 unused OMNIgene® GUT tubes processed for DNA in the Indian laboratory using the QIAamp PowerFecal DNA Kit (QIAGEN) kits as for preparation of experimental sample DNAs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...
-
bioRxiv - Biochemistry 2020Quote: ... 4°C) an applied to a 2 ml Ni-NTA immobilised metal affinity chromatography (IMAC) gravity flow column (QIAGEN, Hilden, Germany). Columns were washed in 10 column volumes (CV ...
-
bioRxiv - Molecular Biology 2021Quote: ... the PCR products were held at 4°C until PCR purification using the QIAquick PCR purification kit (#28106, Qiagen, Hilden, Germany). DNA concentrations were determined using NanoDrop 2000 (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 150 mg of cluster roots (3 to 4 roots) using the RNeasy Plant Mini Kit (Qiagen, 74904) and treated with the DNA-free DNA Removal Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... 100μL chloroform were added and samples spun at 7000rpm for 15min at +4°C in a MaXtract column (Qiagen, Venlo, Netherlands). Mixed with 500μL 70% EtOH and spun at 10 000rpm for 30s at +4°C in a MiniElute column ...