Labshake search
Citations for Qiagen :
501 - 550 of 2785 citations for 2E 4E 2 4 Octadien 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Plant Biology 2024Quote: ... 3-4 plants were pooled and RNA was extracted using the RNeasy plant mini kit (Qiagen). 100 ng of total RNA per sample determined using a Qubit fluorometer (Thermofisher) ...
-
bioRxiv - Plant Biology 2024Quote: ... DNA extractions were performed with the MagAttract PowerSoil DNA kit (Qiagen, Cat. No. 27000-4-KF) optimized for the KingFisher™ Flex Purification System (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) or the E.Z.N.A Total RNA kit I (Omega-Biotek) ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was extracted from 4-day-old Arabidopsis seedlings using RNeasy Plant Mini Kit (Qiagen). For cDNA synthesis ...
-
bioRxiv - Cancer Biology 2024Quote: ... genomic DNA was extracted from 4×107 cells using a Puregene Cell Kit (Qiagen Cat#158043). Lentiviral sgRNA inserts were amplified in a two-step PCR using the primers detailed in Supplementary Table 6 ...
-
bioRxiv - Biochemistry 2024Quote: ... for 4 h at 37 °C and purified with PCR purification kit (QIAGEN, catalog no. 28106) per 20 μL IVT reaction ...
-
bioRxiv - Genetics 2024Quote: ... eluted in 4 µl of scPBS and processed following the REPLI-g SC kit (Qiagen, Germany) manufacturer’s guidelines with an incubation time of 2h ...
-
bioRxiv - Biochemistry 2020Quote: ... The cell lysate was applied on 2 ml of Ni-NTA agarose (QIAGEN) equilibrated with Buffer A ...
-
bioRxiv - Microbiology 2020Quote: ... Soluble ACE 2 was purified using Nickel -NTA agarose beads (Qiagen Cat.No-1018244), eluted with 200mM imidazole ...
-
bioRxiv - Plant Biology 2020Quote: ... The extracted DNA was eluted in 2 x 100 μL EB buffer (Qiagen), cleaned and concentrated with the Clean and Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Biochemistry 2020Quote: ... coli and purified using Qiagen Ni+2 agarose as per vendor protocol (Qiagen). Recombinant proteins were dialyzed in demethylation buffer overnight at 4°C prior to use in enzymatic assays.
-
bioRxiv - Bioengineering 2022Quote: ... submerged for 2 hours in PaxGene fixation reagent at room temperature (Qiagen #765312), kept overnight at 4°C in PaxGene stabilization reagent ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... with 2 × 5 mm stainless steel beads using the TissueLyser (Qiagen, Hilden, Germany) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 2 × 106 cells using QIAzol Lysis Reagent (Qiagen) and cDNA was generated from 0.5 μg of RNA with random hexamers using the GoScript kit (Promega ...
-
bioRxiv - Pathology 2021Quote: Saos-2 cells RNA was extracted using RNeasy mini kit (Qiagen, Catalog#:74104). and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Genetics 2020Quote: ... with the addition of a homogenization step using a TissueLyser 2 homogenizer (Qiagen) with a 4-mm steel bead ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Biochemistry 2022Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with 50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA (2 μg) was treated with bisulfite (EpiTect Bisulfite Kit, Qiagen, Hilden, Germany). The modified DNA was amplified using primers specific for methylated or unmethylated MGMT gene promoters ...
-
bioRxiv - Molecular Biology 2022Quote: ... homogenized for 2 cycles with a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 30 Hz for 3 min each ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2024Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2024Quote: ... (NM-2) one negative control for the kit DNeasy Blood and Tissue (Qiagen) used for DNA extraction of minipig blood and (NM-3 ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Microbiology 2023Quote: ... cultures were mixed with 2 volumes of pre-cooled RNAprotect Bacteria Reagent (Qiagen), and cells were collected by centrifugation (5 min at 4000 × g at 4 °C) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... 400 cotyledons were ground in 2 ml tubes using a Tissue Lyser (Qiagen) for 2 x 1 min at 30 Hz ...
-
bioRxiv - Microbiology 2023Quote: ... and the supernatant was loaded onto 2 ml Ni-NTA Superflow resin (Qiagen). The resin was washed once with 10 mL resuspension buffer and three times with 10 mL resuspension buffer supplemented with 30 mM imidazole ...
-
bioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 2 mL of RNAprotect bacterial reagent (Qiagen; 76506) and incubated at room temperature for 5 minutes prior to storage at - 80°C until further processing ...
-
bioRxiv - Genomics 2023Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen, no. 30250) and kept on a rotator at room temperature for 1 h.
-
bioRxiv - Cancer Biology 2023Quote: ... consisting of 10 μl of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 7.2 μL nuclease-free water ...
-
bioRxiv - Cell Biology 2023Quote: ... Ishikawa and Caco-2 cell lines were transfected with 20 nM siRNA (Qiagen) using JetPRIME (Polyplus Transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleared lysate was passed through 2 mL of Ni-NTA beads (Qiagen), equilibrated with buffer [50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2-mercaptoethanol and then purified using the RNeasy mini kit (QIAGEN) for the QIAcube connect (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... for Day 0 and 2 analyses or AllPrep DNA/RNA Mini Kit (Qiagen) for Day 4 and 6 analyses ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR-2 products were pooled based on concentrations from capillary electrophoresis (QIAxcel, Qiagen). Final libraries were quantified by Qubit dsDNA High Sensitivity assay (ThermoFisher ...