Labshake search
Citations for Qiagen :
501 - 550 of 3715 citations for 2 Methoxy 2 3 4 5 Tetrabde Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: RNA was extracted directly from the frozen samples with the addition of 2 ml of G2 DNA/RNA Enhancer (Ampliqon, Odense, Denmark) using the RNeasy PowerSoil Total RNA Kit (Qiagen, København, Denmark) with phenol:chloroform:isoamyl alcohol following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 600 µl of lysis buffer (TES (0.1 M TRIS, 10 mM EDTA, 2% sodium dodecyl sulphate; pH 8) and Proteinase K (Qiagen, 20 mg/ml) in a 20:1 ratio ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Genomics 2021Quote: ... and Vero E6 cells infected with 2 patient virus isolates was converted to cDNA using reverse transcriptase from qiaseq SARS-CoV-2 primer pool (Qiagen kit, cat no. 333896). APOBEC3b (sense ...
-
bioRxiv - Genomics 2020Quote: ... 5 µL Proteinase-K (20 mg ml-1, Qiagen) was added to the solution and incubated at 60°C for 30 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... A 5 ml Strep-tactin Superflow Plus column (Qiagen) was equilibrated with 50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Genomics 2021Quote: ... then 24 mL buffer PB (5:1, Qiagen #19066) and 1.2mL NaOAc were added sequentially ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lysates were centrifuged at 16,000 g for 5 min and supernatant was treated with 4 µL of RNase A (100 mg/mL) (Qiagen Singapore Pte. Ltd, Cat. No. 19101), gently mixed by flicking of tube and incubated at room temperature for 2 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and 18S rRNA (5’-GAG CGA AAG CAT TTG CCA AG-3’ and 5’-GGC ATC GTT TAT GGT CGG AA-3’) on a Roter-Gene Q (Qiagen, Hilden, Germany) with 2x AmpiGene® qPCR Green Mix Lo-ROX (Enzo Biochem ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was incubated with 3 ml Ni-NTA resins (QIAGEN) with gentle agitation at 4 °C for an hour ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated with binding buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 2 min at 40 Hz using TissueLyser LT (Qiagen). 500 µl PBS-tween (0.01% ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 μg of RNA was treated with Dnase I (Qiagen), copied to cDNA using an Oligo dT and the SuperScript™ II Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the QIAstat-Dx Respiratory SARS-CoV-2 Panel (Qiagen). Viral stocks were produced infecting at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2021Quote: ... or using the QIAseq SARS-CoV-2 Primer Panel (Qiagen) (for organoid supernatants) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 1% 2-mercaptoethanol then passed through Qiashredder tubes (Qiagen). RNA was extracted using the RNeasy Isolation Kit (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... QIAseq SARS-CoV-2 Primer Panel (Qiagen, cat. no. 333895) and QIAseq FX DNA Library Kit were used in order to prepare amplicon libraries for viral genome sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and extension by 2 × multiplex PCR master mix (QIAGEN, USA) at 72 °C for 30 s ...
-
bioRxiv - Genomics 2022Quote: ... and ‘Sy-2’ plants using Genomic Tip (Qiagen, Hilden, Germany), and high-molecular-weight DNA (fragment length > 40 kb ...
-
bioRxiv - Microbiology 2022Quote: ... for 2×2min at 30Hz in a TissueLyser II (Qiagen). After homogenization ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μL of HiPerfect transfection reagent (cat. no. 301705, Qiagen) were mixed with 100 μL NeuroBasal medium without supplements ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNU6-2 (Hs_RNU6-2_11 miScript Primer Assay, Qiagen, MS00033740) as housekeeping miRNA.
-
bioRxiv - Genomics 2023Quote: ... using a TissueLyzer II (QIAGEN, 2min, 25 Hz, 2 times). The samples were incubated at room temperature for 5min ...
-
bioRxiv - Immunology 2023Quote: ... following a 2-step VDJ amplification using HotStarTaq Plus (Qiagen). PCR products were enzymatically cleaned again and illumina adapters and indexes were introduced via PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a 48-sample holder (Tissue Lyser 2, Qiagen). The samples were treated with 1 ml pre-cooled (-20°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and incubated with 4 mg/mL RNase A (Qiagen 158922) diluted 1:286 in 2X SSC for 30 min at 37 °C ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were reverse transfected with 5 pmol of each siRNA (QIAGEN) using lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... was carried out after treatment with 50 μg ml−1 RNase (Qiagen) for 20 min at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... or PAXgene fixative (PFPE, PAXgene Tissue FIX Container; 50 ml; Qiagen, 765312), for 16 hours and subsequently embedded in paraffin wax ...
-
bioRxiv - Molecular Biology 2023Quote: ... Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427) was used to transfect 500 ng of the indicated eGFP plasmid ...
-
bioRxiv - Genetics 2020Quote: ... approximately 30 seeds per genotype were placed in a 2 mL Eppendorf Safe Lock tube along with one stainless steel bead (Qiagen Cat. No. 69989), frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... Pelleted cells were resuspended in 1 ml of Na2CO3 buffer containing 3 µg/ml RNase A (Qiagen) and incubated at 50°C for at least 4 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... The supernatant was loaded over 3 ml of Ni-NTA beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... then resuspended in 3 mL of RNAprotect for bacterial cells (Qiagen, #76506). Planktonic cultures were similarly pelleted and resuspended in RNAprotect ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then applied to a 3 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated overnight with 3 ml Ni-NTA beads (Qiagen) preequilibrated with the extraction buffer ...
-
bioRxiv - Microbiology 2021Quote: ... was added to a column (Qiagen, 5 mL polypropylene column), equilibrated with lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mL erythrocyte lysis buffer (EL buffer, Qiagen, Hilden, Germany) was added and PMNs were centrifuged ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted from the remaining 2 mL of the cell suspension using the RNeasy® Protect Bacteria Mini Kit (QIAGEN, Cat. No. 74524) following the manufacturer instructions.