Labshake search
Citations for Qiagen :
501 - 550 of 3015 citations for 1 2 2 morpholin 4 ium 4 ylethoxy phenyl butan 1 one chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... crushed at 50Hz for 2 minutes with a TissueLyser (Qiagen, ref 85600) and centrifuged at 10000g for 5 minutes at 4°C ...
-
bioRxiv - Genomics 2021Quote: ... and a 2% agarose gel using the QIAquick gel extraction kit (Qiagen). In a second PCR ...
-
bioRxiv - Genomics 2021Quote: SARS-CoV-2 RNA was extracted with QIAamp Viral Mini Kit (Qiagen) in a QIACube extractor or with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... Plant material was then homogenised for 2 min in a tissuelyser (Qiagen) using adaptors kept at −70 °C ...
-
bioRxiv - Physiology 2022Quote: ... with 2 cycles in a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 24 Hz for 2 min each ...
-
bioRxiv - Cancer Biology 2022Quote: ... for DNA extraction and (2) RNeasy Mini Kit (Qiagen, cat. no. 74104) for RNA.
-
bioRxiv - Developmental Biology 2022Quote: ... Samples (2 larvae per tube) were homogenized in a TissueLyser-LT (Qiagen) in 200 μl of the corresponding buffer according to the assay ...
-
bioRxiv - Biochemistry 2022Quote: ... The column was prepared with 2 mL Ni-NTA Agarose Resin (Qiagen). The resin was equilibrated with 10 column volumes of column buffer and resuspended with the supernatant cell extract for 1 h at 4°C with orbital shaking ...
-
bioRxiv - Immunology 2024Quote: ... 2 × QuantiFast SYBR Green PCR Master Mix kit (QiaGen, Cat No. 204056) was used following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen). Then ...
-
bioRxiv - Microbiology 2024Quote: ... The cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... 6b and 6d and the Supplemental Figure 4 we used the RNAeasy Minikit (Qiagen; Cat#74104) following the manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... total RNA was harvested from BMDM 4 hours post-treatment per Qiagen RNA extraction protocol (QIAGEN). RNA was then reverse transcribed to cDNA using iScript Kit (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from E17.5 hearts using the RNeasy Micro Kit (Qiagen; n = 4/genotype), followed by cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Cancer Biology 2023Quote: ... For MdmX knockdown cells were transfected with FlexiTube siRNA Mdm4 (cat.#SI00037163, siMdmX#4) from QIAGEN or costume siRNA against MdmX (siMdmX#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... where it was incubated with 2 mL] Ni-NTA agarose bead slurry (QIAGEN) for 10 min at 4 °C ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from 2×105 H292 using the RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The cell lysate was applied on 2 ml of Ni-NTA agarose (QIAGEN) equilibrated with Buffer A ...
-
bioRxiv - Microbiology 2020Quote: ... Soluble ACE 2 was purified using Nickel -NTA agarose beads (Qiagen Cat.No-1018244), eluted with 200mM imidazole ...
-
bioRxiv - Plant Biology 2020Quote: ... The extracted DNA was eluted in 2 x 100 μL EB buffer (Qiagen), cleaned and concentrated with the Clean and Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Biochemistry 2020Quote: ... coli and purified using Qiagen Ni+2 agarose as per vendor protocol (Qiagen). Recombinant proteins were dialyzed in demethylation buffer overnight at 4°C prior to use in enzymatic assays.
-
bioRxiv - Bioengineering 2022Quote: ... submerged for 2 hours in PaxGene fixation reagent at room temperature (Qiagen #765312), kept overnight at 4°C in PaxGene stabilization reagent ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... with 2 × 5 mm stainless steel beads using the TissueLyser (Qiagen, Hilden, Germany) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 2 × 106 cells using QIAzol Lysis Reagent (Qiagen) and cDNA was generated from 0.5 μg of RNA with random hexamers using the GoScript kit (Promega ...
-
bioRxiv - Pathology 2021Quote: Saos-2 cells RNA was extracted using RNeasy mini kit (Qiagen, Catalog#:74104). and gene expression was carried using the RT² Profiler PCR Array for human cellular stress responses (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Genetics 2020Quote: ... with the addition of a homogenization step using a TissueLyser 2 homogenizer (Qiagen) with a 4-mm steel bead ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...