Labshake search
Citations for Qiagen :
5151 - 5200 of 10000+ citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... DNA was isolated using Puregene Core Kit B (Qiagen) according to the manufactureŕs instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... and Plasmid Plus Maxi Kits (cat. no. 12963, Qiagen). Lentiviral transduction was performed by co-transfection of HEK-293T cells with 10 μg of pLX_307 vector (BRD4 or GFP control) ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was extracted using RNeasy Plus Mini Kit (Qiagen), following manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids were isolated using a Spin Miniprep Kit (Qiagen) and verified via enzymatic restriction ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted with Qiagen RNeasy kit (Qiagen 74004) and quantified by Qubit (Thermo Q10211) ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted using Rneasy plus mini kit (Qiagen) and cDNA was generated using High-Capacity RNA-to-cDNATM kit (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: RNA was isolated with the RNeasy Mini Kit (Qiagen). The Illumina Truseq Total RNA protocol (ribosomal depletion ...
-
bioRxiv - Cell Biology 2024Quote: Total RNAs were prepared with RNeasy Mini Kit (Qiagen) and the retrotranscribed with Superscript III First-Strand Synthesis System (Invitrogen) ...
-
Inhibition of p38-MK2 pathway enhances the efficacy of microtubule inhibitors in breast cancer cellsbioRxiv - Cancer Biology 2024Quote: ... RNAs were purified by the RNeasy Mini Kit (Qiagen). Sequencing libraries were prepared with the TruSeq stranded mRNA kit and sequenced on NovaSeq6000 at Macrogen Japan ...
-
bioRxiv - Cancer Biology 2024Quote: ... and RNA was prepared using a RNeasy kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was isolated using the miRNeasy kit (Qiagen, 217084). cDNA libraries were prepared and sequenced by Novogene ...
-
bioRxiv - Cancer Biology 2024Quote: ... or AllPrep DNA/RNA Mini Kit (Qiagen, Cat #80204) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... or AllPrep DNA/RNA Mini Kit (Qiagen, Cat #80204) per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was recovered using the RNeasy Mini Kit (Qiagen). Total RNA was quantified by Bioanalyzer and Qubit (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... using the AllPrep DNA/RNA/miRNA Universal kit (Qiagen) according to the manufacturer’s instructions including proteinase K and DNase treatment ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted using RNeasy kit (Qiagen, Hilden, Germany) as previously described (32) ...
-
bioRxiv - Genetics 2024Quote: ... DNA was extracted using QIAprep Spin Miniprep Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... and DNA was isolated by Gel Extraction Kit (Qiagen). Paired-end sequencing was performed using the NextSeq platform with automated demultiplexing and adaptor trimming (Illumina) ...
-
bioRxiv - Genetics 2024Quote: ... we extracted the plasmids (QIAprep Spin Miniprep Kit, Qiagen). We verified the plasmid sequences using Sanger sequencing with an M13 primer (AGCGGATAACAATTTCACACAGGA).
-
bioRxiv - Genetics 2024Quote: ... or a DNeasy 96 Blood & Tissue Kit (Qiagen, Germany). We first applied whole-exome sequencing to sequence the exonic regions ...
-
bioRxiv - Cell Biology 2024Quote: ... pUAST-myc::dPLDΔPX -attB using Effectene transfection kit (Qiagen) following manufacturer’s protocol for 36 h ...
-
bioRxiv - Cell Biology 2024Quote: ... Total mRNA was isolated using the RNeasy kit (Qiagen), and reverse transcription (RT ...
-
bioRxiv - Cell Biology 2024Quote: ... and purified by RNeasy MiniElute Cleanup Kit (QIAGEN, 74204).
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA was extracted using the DNeasy PowerWater Kit (QIAGEN), libraries were prepared with the NEBNext Ultra II DNA Library Prep kit (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... where the DNeasy Plant Maxi Kit (Qiagen, Venlo, Netherlands) was used instead ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and further purified with PCR Cleanup Kit (#28104, Qiagen).
-
bioRxiv - Cell Biology 2024Quote: ... RNA was isolated using an RNeasy mini kit (Qiagen). Quality and concentration of RNA were determined using a 2100 Bioanalyzer Instrument (Agilent) ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was isolated using RNeasy Mini Kit (QIAGEN). Ribo-Zero rRNA Removal kit (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: RNA was extracted using RNeasy mini kit (74104, Qiagen) by following the manual instructions ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was isolated using a RNeasy kit (Qiagen) according to the manufacturer’s instructions and transcripts detected in a one-step RT–qPCR reaction using 30 ng of total RNA and Quantitect SYBR green reagent (Qiagen) ...
-
Dissecting the regulatory logic of specification and differentiation during vertebrate embryogenesisbioRxiv - Developmental Biology 2024Quote: ... followed by purification using MinElute PCR Purification Kit (QIAGEN). The ORF amplicon was directionally ligated to the vector using T4 DNA ligase (New England Biolabs #M0202S ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA was isolated using RNeasy Mini Kit (Qiagen 74104) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: RNA extraction was performed using RNeasy Mini Kit (Qiagen). 500ng of RNA was used to generate libraries with QuantSeq 3’ mRNASeq Kit (Lexogen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA was extracted using DNeasy Blood & Tissue Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was extracted using the RNeasy kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: RNA was isolated using the RNeasy Mini Kit (Qiagen) from transfected HPAECs after shear stress experiments by pooling 3-4 Ibidi I Luer slides for each condition ...
-
bioRxiv - Neuroscience 2021Quote: ... qRT-PCR was performed to amplify microRNA 223-3p using the primer hsa-miR-223-3p miRCURY LNA miRNA PCR Assay (Qiagen, #339306, gene Globe ID: YP00205986) and LNA SYBR green PCR kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Relative-fold changes were normalized comparing exosomal micro RNA reference gene miR-30c-5p using the primer hsa-miR-30c-5p miRCURY LNA miRNA PCR Assay (Qiagen 339306, gene globe ID YP00204783). Relative fold changes of miR223-3p of fro/fro mice were calculated to +/fro mice by using the formula ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from leaves and roots samples by using The Plant RNeasy extraction kit (RNeasy Plant Mini Kit, Qiagen, Valencia, CA, USA). To remove any residual genomic DNA ...
-
bioRxiv - Cancer Biology 2021Quote: Total DNA from xenograft tissue samples was isolated using a commercially available column-based purification kit from QIAGEN (DNeasy Blood and Tissue Kit) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Further processing was performed with agreement of the RNA extraction protocol using the Qiagen Purification of Total RNA Kit for Yeast with Optimal On-Column DNase Digestion (RNeasy Mini Kit (50) (Qiagen, catalog no. 74104).
-
bioRxiv - Molecular Biology 2022Quote: ... and the DNA pellet was stored at −80°C until purification was performed using a commercial kit (DNeasy Blood and Tissue Kit, catalog #69504; Qiagen; Germantown, MD, USA) according to manufacturer’s instructions with a minor modification to the elution step ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from each sample using a miRNeasy Mini Kit and a RNeasy MinElute Cleanup Kit (both from (Qiagen, Valencia, CA, USA)) ...
-
bioRxiv - Epidemiology 2020Quote: Total RNA was extracted from tissue and serum samples using two commercial kits according to the manufacturer’s instructions: QIAamp® RNA Blood for tissues and QIAamp® Viral RNA Kit for serum (Qiagen Inc., Germany). Viral RNA was detected using two previously published RT-qPCR techniques (16,17).
-
bioRxiv - Genomics 2021Quote: ... DNA was removed with the Ambion® DNA-free™ Kit following the standard procedure and purified with the RNeasy® Mini Kit (QIAGEN).
-
bioRxiv - Biochemistry 2021Quote: RNA from both rabbits was extracted from lymph nodes and spleen using the RNeasy mini kit and from blood samples using the RNeasy Protect Animal Blood kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer′s instructions ...
-
bioRxiv - Immunology 2023Quote: ... The crypts were placed in lysis buffer (RLT, provided in RNeasy® Mini Quiagen Kit, 74104) and RNA was isolated following manifacturer instructions (RNeasy® Mini Kit, Qiagen, 74104). RNA quantification was done by spectrophotometry (ND1000 Spectrophotometer ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... flies were separated in to four pools of 25 and DNA was extracted using a column-based DNA extraction kit (DNeasy Qiagen kit, Cat # 69506). The extracted DNA from each of the four pools of 25 for distinct samples were combined such that the same concentration of DNA was added from each pool (equimolar) ...
-
bioRxiv - Microbiology 2024Quote: ... while the marine and freshwater samples were extracted using the DNeasy® PowerWater® Kit and RNeasy® PowerWater® Kit (QIAGEN, Germany). The extracted nucleic acid was then subject to library construction using NEBNext Ultra RNA Library Prep Kit and NEB Next Ultra DNA Library Prep Kit (LTD.NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... we isolated viral RNA from xenograft tumors using either a Qiagen viral RNA kit or Trizol followed by the Qiagen viral RNA kit (Qiagen, Germantown, MD, USA). The isolated RNA was then submitted to the University of Minnesota Genomics Center (UMGC ...